Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting high myopia

A technology of high myopia and a kit, which is applied in the measurement/testing of microorganisms, biochemical equipment and methods, etc., can solve the problems of ineffective control of myopia progress, effective treatment of patients, and yet to be verified, and achieve a good market application prospect Effect

Active Publication Date: 2012-10-17
SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] So far, treatments for high myopia are limited and ineffective
Optical correction Correcting the refractive defect of myopia by wearing glasses or contact lenses, although it can help temporarily restore normal or near-normal vision, but it cannot effectively control the progression of myopia; vitreous surgery for some high myopia with macular degeneration Combined with laser treatment, as well as lengthening the eye axis through surgery to delay the appearance of fundus lesions and reduce the degree of lesions, these are the most commonly used intervention methods in clinical practice. These treatments can improve or stabilize postoperative visual acuity and stabilize or reduce diopter , the growth of the eye axis tends to be slow, and it can slightly improve the functional changes, but these treatments are not effective for all patients, and there are certain risks in the operation. The main complications of the operation are postoperative retinal detachment and vortex vein arterial injury, and its long-term effect has yet to be verified
In addition, it has been reported that drugs can be used to control the pathological changes of eye axial growth and high myopia, but it is still in the experimental stage and needs further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting high myopia
  • Kit for detecting high myopia
  • Kit for detecting high myopia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Sample collection and extraction of genomic DNA

[0063] The family and case samples are all from the National Natural Science Foundation of China (project number: 30900809, 81170883), the National Outstanding Youth Fund (81025006), and the 973 project undertaken by the Sichuan Provincial Key Laboratory of Human Disease Gene Research, Sichuan Academy of Medical Sciences Sichuan Provincial People's Hospital Samples collected by the sub-project (2011CB504604) and the Sichuan Science and Technology Department project (2010SZ0138). There were 30 members of the high myopia family (951) (20 survived), including 10 highly myopic patients (6 survived); 300 cases of sporadic highly myopic patients, with an average age of 33.6±12.6 years, of which 46.3% were male, and normal controls 600 cases (inclusion criteria: over 40 years old, long-term close work, diopter>-1.0D), mean age 55.8±9.2 years, 47.8% of them were male (Table 1). All subjects were of Han nationality and...

Embodiment 2

[0069] Example 2 Detection of the 2156-position A→G mutation site of the ZNF644 gene

[0070] 1. Detection method

[0071] 1. Extract the blood genome DNA of the surviving members of the high myopia family (951)

[0072] 2. Detection of the A→G mutation site at position 2156 of the ZNF644 gene

[0073] (1) PCR amplification:

[0074] Using the genomic DNA obtained in step 1 as a template and the primer pair A (upstream primer: ACCAGGAGAGAAGACAGAAG; downstream primer: TTTTGAAATGCACAGGATAT) shown in SEQ ID NO.

[0075] System: 2×PCRmix 10μl, upstream and downstream primers (5pm) 1μl each, template DNA (30ng / μl) 1μl, ddH 2 O 7 μl.

[0076] Program: Denaturation at 95°C for 5 minutes; 35 cycles at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute; extension at 72°C for 7 minutes, and incubation at 12°C.

[0077] The amplified product is the sequence (879bp) shown in SEQ ID NO.3-4:

[0078] ACCAGGAGAGAAGACAGAAGttgatggaggaaattcgtgaattgaa...

Embodiment 3

[0091] Example 3 Detection of ZNF644 gene 1901-position A→G mutation, 2180-position C→G mutation, 2238-position G→A mutation, 4138-position C→G mutation and 4718-position G→A mutation

[0092] 1. Detection method

[0093] 1. Extract blood genome DNA from 300 sporadic high myopia patients and 600 normal controls

[0094]2. ZNF644 gene 1901 A→G mutation site, 2180 C→G mutation site, 2238 G→A mutation site, 4138 C→G mutation site and 4718 G→A mutation site The detection method of these 5 mutation sites is the same as the detection method of the 2156 A→G mutation site of the ZNF644 gene in Example 2, and their PCR amplification primers, amplification products and sequencing primers are respectively:

[0095] 1901 A→G mutation site:

[0096] PCR amplification primer: the sequence (primer pair A) shown in SEQ ID NO.1~2, same as the amplification primer at position 2156;

[0097] Amplified product: the sequence shown in SEQ ID NO.6-7 (879bp)

[0098] ACCAGGAGAGAAGACAGAAGttgatggag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diopteraaaaaaaaaa
Login to View More

Abstract

The invention provides a kit for detecting high myopia, comprising an optional reagent for detecting the mutations of one or more loci of 1901, 2156, 2180, 2238, 4138, and 4718 of ZNF644 gene. The invention further provides an application of the mutations of one or more loci of 1901, 2156, 2180, 2238, 4138, and 4718 of ZNF644 gene in preparing a reagent for detecting high myopia. The kit provided by the invention can predict the susceptibility of a sample to be detected to high myopia, can be used for early monitoring and detecting high-risk population of high myopia, and can be used for carrying out early prevention and treatment to reduce visual loss.

Description

technical field [0001] The invention relates to a kit for detecting high myopia, in particular to a kit for detecting ZNF644 gene variation related to high myopia. Background technique [0002] High myopia (high myopia, HM), also known as pathological myopia and malignant myopia, refers to myopia with a diopter above -6.00D, with elongation of the eye axis, deformation of the posterior pole of the eye, thinning of the sclera, and atrophy and thinning of the choroid And other pathological changes, accompanied by amblyopia, glaucoma, cataract, vitreous opacity, retinal detachment and other complications. [0003] High myopia is a kind of blinding eye disease, and its etiology and pathogenesis are very complicated. High myopia is familial and has obvious genetic tendency, and the prevalence rate is high, and there are racial differences. In my country, high myopia is an autosomal recessive inheritance, manifested as myopia in children (pre-school age), progressive increase in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 杨正林金鑫石毅蒋涛鲁芳杨旭刘小琦尹烨
Owner SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More