Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b

A key gene and root development technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of no WOX gene family and unclear regulatory network

Inactive Publication Date: 2012-07-18
NANJING FORESTRY UNIV
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The regulatory network between them and related genes and plant hormones is not very clear, and there is no report on the function of WOX gene family in poplar

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b
  • Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b
  • Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0036] Example 2 Cloning of the PeWOX11a gene by RACE technology

[0037] Using the 895 poplar cDNA prepared in Example 1 as a template, use specific primers to amplify the short fragment of the PeWOX11b gene, wherein the forward primer for amplifying the short fragment of PeWOX11b is: 5'AACGCCAGATGCAAGCTAGT 3 The reverse primer for amplifying the PeWOX11b short fragment is: 5’TCTGTTGGAACCCCATTGAT 3 The high-fidelity PCR reaction system is as follows: 10×LA PCR Buffer (Mg 2+ free) 5.0μL; 2.5mM dNTP Mixture 8.0μL; 25mM Mg 2+ 5.0 μL; LA Taq DNA Polymerase (5U / μL) 0.5 μL; forward primer (10 μM) 2 μL; reverse primer (10 μM) 2 μL; template (895 poplar cDNA) 1 μL; add sterile ddH 2 O to make up 50 μL. Reaction program: pre-denaturation at 94°C, 3min; 94°C, 40s, 55°C, 30s, 72°C, 30s, 35 cycles; 72°C, 10min. The product was sequenced, and the obtained PeWOX11a gene short fragment sequence is shown in SEQ NO3.

[0038] According to the short fragment sequence of PeWOX11a gene ...

Embodiment 3

[0078] The genetic transformation of embodiment 3PeWOX11b gene

[0079] The constructed pH35GS-PeWOX11b overexpression vector was transformed into Agrobacterium strain EHA105 (Invitrogen) by liquid nitrogen freeze-thaw method, and PeWOX11b gene was transferred into poplar through Agrobacterium-mediated. The result is as Figure 2-7 As shown, among them, figure 2 Semi-quantitative detection for transgenic poplar overexpressing PeWOX11b gene; image 3 It is a comparison of the overall morphology of the transgenic poplar overexpressing the PeWOX11b gene and the non-transgenic poplar. In the figure, the non-transgenic poplar is on the left, and the transgenic poplar is on the right; Figure 4 Comparison of root morphology between transgenic poplar overexpressing PeWOX11b gene and non-transgenic poplar. In the figure, non-transgenic poplar is on the left, and transgenic poplar is on the right; Figure 5 Transgenic poplar overexpressing PeWOX11b gene was subcultured for 10 weeks...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a key gene PeWOX11b for adventitious root development of poplar. The nucleotide sequence of the key gene PeWOX11b is shown by SEQNO1. According to the key gene PeWOX11b and the application thereof disclosed by the invention, the PeWOX11b gene is transferred into the poplar, so that the number of adventitious roots of transgenic poplar for over-expression of the PeWOX11b gene is increased, adventitious roots grow on stems and new plants can also grow on the adventitious roots at different positions, the result shows that the PeWOX11b gene is a key factor for controlling the generation and the development of the adventitious roots of the poplar and has an important application value in the fields of forest genetic engineering and vegetative forestry.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to a poplar adventitious root development key gene PeWOX11b and an application thereof. Background technique [0002] Poplar is one of the most widely cultivated tree species in the mid-latitude plains of the world, and it is also one of the important fast-growing industrial timber tree species and afforestation tree species in my country, which has played an important role in the sustainable development of clonal forestry in China. With the continuous promotion of new varieties of fast-growing and high-yielding poplars, the poplar planting industry in various places has developed rapidly. At present, the area of ​​poplar plantations in my country has exceeded 7 million hectares, ranking first in the world. Generally speaking, poplar is a tree species suitable for vegetative propagation. Among various vegetative propagation methods, hard branch cuttings ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/84C12N5/10A01H5/06C07K14/415
Inventor 胥猛谢雯凡黄敏仁陈英王光萍潘惠新徐立安王明庥
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com