Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

cDNA of glutathione-s-transferase (GST) gene in ostrinia furnacalis and method for constructing RNAi interference engineering bacteria of GST gene in ostrinia furnacalis

A technology of glutathione and transferase, which is applied in DNA/RNA fragment, genetic engineering, transferase and other directions, can solve the problem that there is no report on the glutathione-S-transferase gene of corn borer, and achieves low cost, The effect of inhibiting growth and development and reducing tolerance

Inactive Publication Date: 2011-09-14
HEILONGJIANG UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the full-length cDNA and cDNA fragments of GST have been cloned in many insects, but there is no report on the glutathione-S-transferase gene of the corn borer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cDNA of glutathione-s-transferase (GST) gene in ostrinia furnacalis and method for constructing RNAi interference engineering bacteria of GST gene in ostrinia furnacalis
  • cDNA of glutathione-s-transferase (GST) gene in ostrinia furnacalis and method for constructing RNAi interference engineering bacteria of GST gene in ostrinia furnacalis
  • cDNA of glutathione-s-transferase (GST) gene in ostrinia furnacalis and method for constructing RNAi interference engineering bacteria of GST gene in ostrinia furnacalis

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0015] Specific embodiment 1: In this embodiment, the cDNA of the corn borer glutathione-S-transferase gene has a full length of 886 bp, and the nucleotide sequence is:

[0016] TCGCGGATCCACAGCCTACTGATGATCAGTCGATGGAAAAGTCTTACTGTGGAGTTCTGAAGCGGTGCACGCGAGTTTCAAAGCTACA TCGATCGACCTTTACTACACGGCCGGGTCAGCGCCCTGTCGCCTGGTGTTACTGGTGGCTGCCGCTCTGAACCTCGAACTCAACCTTAAGCCTCTAGACTTAAGGGCTGGAGAACAGCTCACACCAGAATTTTTACAGCTGAACCCACAACACACAGTTCCCACGATCATAGACGACGGCTTTTCGCTAAATCCTCCACACACAGTTCCCACGATCGTAGACGACGGCTTTTCGCTATGGGAATCGCGCGCCATCAGCCGATACCTGGTCAACAAGTACGGAGGGGCAGCCCTGTACCCTGAGGACCCGAAGGCGAGGGCTTTGGTGGACCAGAGACTGGACTTCGACTTGGGTACACTGTACCCCAGATTTGCGACGTACTTTTATCCCCAAGTCCTCGCTGGTGCTCCTGCTGACGAAGCCTTGTTGAAGATGCTGGAAGAGGCTCTCAAGTTCCTGGACACCTTCCTCGAAGGTCAGAAGTATGCTGCGGGCTCAGAACTGACCTTGGCTGACCTGTCGCTCGTGGCTACTGTGTCTACTATTGACGCTGCTGGCATATCCATCGAATCCTACCAGAGTGTCAACAAGTGGTTCACGCTGGTCAAATCTACCGCCCCCAAATACGACGAAGCGAACGGCCAAGGCGTAGAAATGTTTAGAGCCTTCGTGGCACAGCTCAAAGCCAAGACGGAGCTG TCGTGAGACTGGTATAGTGCATAGTTTT...

specific Embodiment approach 2

[0021] Specific implementation manner 2: In this embodiment, the construction of the corn borer glutathione-S-transferase gene RNAi interference engineering bacteria is carried out according to the following steps: 1. Use the Trizol method to extract the total RNA of the midgut of the third instar larvae of the corn borer, and use the cDNA reverse The transcription kit synthesizes the first strand of cDNA, and design the specific upstream primer Of-GST-RNAi320-P1 and downstream primer Of-GST-RNAi320-P2 according to the specific functional dsRNA fragment, and then use the cDNA first strand obtained above as The template was amplified by PCR to obtain the target fragment Of-GST-RNAi320; 2. The target fragment Of-GST-RNAi320 and the expression vector L4440 were double-enzyme digested with Pst I and HindIII respectively, and the required target fragments were recovered, connected and constructed a recombinant plasmid L4440-Of-GST; 3. Transform the constructed recombinant plasmid L44...

specific Embodiment approach 3

[0027] Specific embodiment three: This embodiment is different from the specific embodiment two in that the Of-GST-RNAi320 double digestion system in step two is as follows:

[0028] Ingredients Dosage

[0029] Of-GST-RNAi320 10μL

[0030] Pst I 1μL

[0031] HindIII 1μL

[0032] 10×M Buffer 2μL

[0033] ddH 2 O 20μL.

[0034] Other steps and parameters are the same as in the second embodiment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to cDNA of a glutathione-S-transferase (GST) gene and a method for constructing RNAi interference engineering bacteria of the GST gene, in particular to cDNA of a glutathione-S-transferase (GST) gene in ostrinia furnacalis and a method for constructing RNAi interference engineering bacteria of the GST gene in the ostrinia furnacalis. The nucleotide sequence and amino acid sequence of the GST gene in the ostrinia furnacalis respectively refer to SEQ ID NO.1 and SEQ ID NO.2. The method comprises the following steps: 1. extracting the total DNA of the ostrinia furnacalis, synthesizing the first cDNA chain, designing primers and carrying out PCR (polymerase chain reaction) amplification to obtain Of-GST-RNAi320; 2. carrying out double digestion on Of-GST-RNAi320 and L4440, recovering the needed target fragments and connecting the target fragments and constructing L4440-Of-GST; and 3. transforming L4440-Of-GST to escherichia coli HT115 (DE3), thus completing the construction. The method is simple to operate, is low in cost and has obvious effect on inhibiting growth and development of the ostrinia furnacalis.

Description

Technical field [0001] The invention relates to the construction of cDNA of glutathione-S-transferase gene and its RNAi interference engineering bacteria. Background technique [0002] The corn borer (Ostrinia furnacalis), commonly known as the borer, is one of the world's major pests. Its feeding habits are complex and widely distributed. North China, Northeast China, and Northwest my country are areas where corn borer is seriously harmed. It mainly damages corn, sorghum and cotton. It is a specialized pest of corn. It mainly feeds on corn plants and tassels by larvae, causing worm holes and stems on the leaves of the plants. The broken rod caused a reduction in production. According to statistics, corn borer damage caused corn yields to be reduced by as much as 10% to 30%. Moreover, in recent years, due to changes in factors such as climate warming and corn planting density, the damage of corn borer has been increasing. [0003] At present, the control measures for corn borer m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/113C12N15/63C12N1/21C12R1/19
Inventor 杨峰山张一桐刘春光刘丽萍陈思学
Owner HEILONGJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com