Primer group and kit for multiple PCR detection of rabbit Pasteurella multocida and rabbit Bordetella bronchiseptica and detection method thereof
A technology of Pasteurella rabbits and Bordetella rabbits, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of not finding Pasteurella rabbits, etc., and achieve the effect of long course of disease
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The kits and detection methods involved in this embodiment are as follows.
[0034] 1. Kit
[0035] The multiplex PCR detection kit of this embodiment includes 7 cryopreservation tubes, 50 PCR reaction tubes and instructions. The 7 cryopreservation tubes are respectively: code-named cryopreservation tube A (2) containing 2×PCR core reagent premix (Taq enzyme, dNTPs mixture and MgCl 2 solution, commercially available), cryopreservation tubes B and C are respectively equipped with 50ul positive DNA solutions of Pasteurella rabbit and Bordetella, cryopreservation tube D is equipped with 0.5ml DL2000 molecular weight standard solution (commercially available), and cryopreservation tube E is equipped with 1.5mlddH 2 O, cryopreservation tube F is equipped with the primer mixture used in the PCR system, Pasteurella rabbit primers: 5'GAGTCTAGAGTACTTTAGGGA 3', 5'ACTTTCTGAGATTCGCTC 3'; Bordetella rabbit primers: 5'TGAACAATGGCGTGAAAG 3', 5'TCGATAGTAGGACGGGAGG 3'; All cryovials ...
Embodiment 2
[0047] The materials involved in this case are as follows: reference strains of Pasteurella, Bordetella, Salmonella, Escherichia coli, and Clostridium welchii from rabbits were all purchased from China Veterinary Drug Control Institute.
[0048] Inoculate the above bacteria into 2ml enrichment broth medium, cultivate overnight at 37°C, and then conduct the following tests:
[0049] 1. Sensitivity test
[0050] The Pasteurella and Bordetella bacterial liquids that were shaken overnight at 37°C were serially diluted 10 times, and after plate counting, multiple PCR reactions were performed to detect the sensitivity. The results are as follows: figure 1 , figure 2 as shown,
[0051] 2. Specificity test
[0052] After resuscitating and culturing rabbit Pasteurella, Bordetella, Salmonella, Escherichia coli, Clostridium welchii, etc., extract DNA for specificity test. The result is as image 3 shown.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com