Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Methods and compositions related to immunizing against staphylococcal lung diseases and conditions

A staphylococcus, lung disease technology, applied in the fields of immunology, microbiology, epidemiology and medicine, to solve problems such as the difficulty of vaccine protection

Active Publication Date: 2011-01-19
UNIVERSITY OF CHICAGO
View PDF65 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Menzies and Kernode also describe the difficulty and expected failure of using single-component vaccines to confer protection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and compositions related to immunizing against staphylococcal lung diseases and conditions
  • Methods and compositions related to immunizing against staphylococcal lung diseases and conditions
  • Methods and compositions related to immunizing against staphylococcal lung diseases and conditions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0218] Vaccine-mediated protection against Staphylococcus aureus

[0219] A. method

[0220] Bacterial strains and cultures. Staphylococcus aureus Newman, LAC and MW2 were propagated in Tryptone Soy Broth (TSB) or Tryptone Soy Agar (TSA). To obtain PVL-transformed phage, lytic replication of φSa2mw in S. aureus MW2 cultures was induced with 1 μg / ml mitomycin C. The lysate was filtered with a 0.22 μm membrane and the filtrate was used for plaque formation on S. aureus RN4220 (Bae et al. 2006). The phage suspension was mixed with 1 ml of the mid-log phase culture of bacterial strain RN4220 (grown in 5 mM CaCl 2 heart infusion broth (HIBCa5)) and then amplified by overnight incubation at 37°C. DNA was purified from amplified phage particles by phenol / chloroform extraction. φSa2mw was detected by PCR amplification of lukS-PV DNA using primers cctcctgttgatggaccact (SEQ ID NO: 3) and ggcgctgaggtagtcaaaag (SEQ ID NO: 4). The φSa2mw phage solution was mixed with a mid-log cult...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Embodiments of the invention include methods and compositions useful in a vaccination strategy capable of neutralizing HIa to provide immunoprotection against S. aureus pneumonia. In certain aspects the invention includes a HIa with reduced toxicity, represented by a recombinant mutant form of HIa (HlaH35L) in which histidine 35 is converted to leucine, which can be used to abrogate the productive assembly of the toxin and protect a subject from staphylococcal pneumonia.

Description

[0001] This application claims priority to US Provisional Application Serial No. 60 / 969,514, filed August 31, 2007, which is hereby incorporated by reference in its entirety. [0002] This invention was made with government support (AI38897 and AI52474 awarded by the National Institutes of Health, and HD00850 awarded by the National Institutes of Child Health and Human Development). The government has certain rights in this invention. Background of the invention [0003] I.Technical field [0004] The present invention relates generally to the fields of immunology, microbiology, epidemiology and medicine. In a more specific embodiment, it relates to methods and compositions for generating an immune response against bacteria containing exotoxin proteins such as alpha-hemolysin. [0005] II. Background technology [0006] Current methods of treating S. aureus pneumonia rely on antimicrobial drugs, against which organisms have a clear tendency to acquire resistance. The patho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/085C07K16/12A61K39/395A61P31/04
CPCA61K39/40C07K16/1271A61K39/085C07K2316/96A61K2039/505C07K2317/565C07K2317/76A61P11/00A61P31/04A61P37/04
Inventor 朱利安娜·布贝克-沃登伯格奥拉夫·施内温德布鲁克·拉格莱
Owner UNIVERSITY OF CHICAGO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com