Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers
A technology of RNA interference and multiple primers, applied in the field of biological gene cloning and expression technology, can solve the problems of not being suitable for high-throughput, time-consuming, and heavy workload, so as to avoid base synthesis errors, save time and cost, and reduce the probability of errors Reduced effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Utilize the present invention, construct the plant artificial microRNA (amiRNA) expression vector (specific process sees figure 1 ).
[0032] 1) Transformation of the carrier
[0033] In this experiment, the plant binary vector pCAMBIA1301 was selected as the starting vector, and the vector was digested with EcoRI and BstEII and then ligated with the following fragments: 35S promoter-HindIII restriction site-gfp expression unit-NcoI restriction site (details The sequence is attached), to obtain the universal plant RNAi expression vector pYH1301-gfp (see figure 2 ).
[0034] 2) Design and annealing of oligonucleotide sequence
[0035] According to the rice miR528 precursor sequence reported in the literature (PLoS One.2008Mar 19; 3(3):e1829.), design the sequence that can transcribe the small RNA that interferes with the pds gene, and synthesize a set (8 in this case) of length It is an oligonucleotide sequence of about 50nt (the detailed sequence is attached).
[...
Embodiment 2
[0040] Utilize the present invention to construct the animal shRNA expression vector with mammalian interference vector pGenesil-1 (Wuhan Jingsai Bioengineering Co., Ltd.) as the backbone and GCTGTACTCCCCTTACATTA as the interference target sequence (see image 3 ).
[0041] 1) Transformation of the cloning vector
[0042] To analyze the vector sequence, first select the mammalian interference vector pGenesil-1 as the starting vector, linearize it with BamH I and Xho I double enzyme digestion, and fragment "Nb.BbvCI restriction site--front annealing sequence--EcoRV Restriction site--gfp expression unit--EcoRV restriction site--rear-end annealing sequence--Nb.BbvCI restriction site" connection (detailed sequence is attached) to obtain a general-purpose gene that can be used to construct animal shRNA expression vectors Type vector pGsilG-Lic ( Figure 4 );
[0043] 2) Design and annealing of oligonucleotide sequence
[0044] According to the principle in step 2) of the specif...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap