Supercharge Your Innovation With Domain-Expert AI Agents!

Artificial sequence for increasing methionine content of soy and plant expression vector thereof

A technology of methionine and content, applied in the direction of introducing foreign genetic material, DNA/RNA fragments, recombinant DNA technology using vectors, etc., can solve problems such as poor stability and achieve the effect of increasing the content of methionine

Active Publication Date: 2013-03-13
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to solve the problem of poor stability in the current method of improving soybean methionine content by transgenic technology, and to provide an artificial sequence for increasing soybean methionine content and its plant expression vector

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificial sequence for increasing methionine content of soy and plant expression vector thereof
  • Artificial sequence for increasing methionine content of soy and plant expression vector thereof
  • Artificial sequence for increasing methionine content of soy and plant expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0011] Embodiment 1: The sequence of the artificial sequence HSSP for increasing soybean methionine content in this embodiment is as follows:

[0012] ATGGCTGCTAAGATGTTGGCTCTCTTCGCTCTCTTGGCTCTCTGCGC TTCAGCTACCTCAGCTACCCATATCCCTGGTCATCTCCCTCCTGTTATGC CCTTGGGAACCATGAACCCTTGCATGCAGTATTGCATGATGCAGCAGGG TCTCGCTTCACTCATGGCTTGCCCTTCTCTCATGCTCCAGCAGTTGCTCG CTCTCCCTCTCCAGACTATGCCTGTTATGATGCCTCAGATGATGACCCCTAACATGATGTCTCCTTTGATGATGCCTTCTATGATGTCTCCCATGGTTCT CCCTTCTATGATGTCTCAGATCATGATGCCTCAGTGCCATTGCGACGCTG TTTCTCAGATTATGTTGCAGCAGCAGTTGCCCTTCATGTTCAACCCTATG GCTATGACCATTCCTCCTATGTTCCTCCAGCAGCCCTTCGTTGGTGCTGC TTTCTAA。

specific Embodiment approach 2

[0013] Specific embodiment two: the difference between this embodiment and specific embodiment one is: the omega translation enhancer sequence and the plant translation initiation codon consensus sequence kozak are added upstream of the artificial sequence HSSP, and the mRNA tailing signal sequence and clipping sequence are added downstream of the artificial sequence HSSP. cut sequence. Other steps and parameters are the same as those in Embodiment 1.

[0014] The structural map of the artificial sequence that increases the content of soybean methionine in this embodiment is as follows figure 1 shown.

[0015] This embodiment carries out prokaryotic expression test:

[0016] The artificial sequence for increasing soybean methionine content in this embodiment is constructed on the prokaryotic expression vector pET-32b, and transformed into Escherichia coli BL21 (DE3). Use liquid LB medium to activate Escherichia coli BL21 (DE3pET-32b) and 3 strains of BL21 (DE3pET-32b-HSSP) ...

specific Embodiment approach 3

[0018] Specific embodiment three: the plant expression vector of the artificial sequence that improves soybean methionine content in this embodiment includes artificial sequence HSSP, and the upstream of the artificial sequence HSSP of the plant expression vector includes the E12 enhancer sequence and the seed-specific expression promoter Pgy2, and the artificial sequence HSSP of the plant expression vector Downstream contains the Tnos terminator sequence.

[0019] Specific implementation mode four: combination image 3 Illustrate this embodiment, this embodiment constructs the plant expression vector of the artificial sequence that improves soybean methionine content according to the following steps:

[0020] 1. Digest the plasmid pUH with Xba I and Sac I to recover the 640bp fragment;

[0021] 2. Simultaneously use Xba I and Sac I to double-digest the vector cassette pBEGT to recover large fragments of DNA;

[0022] 3. Connect the two fragments recovered in step 1 and step...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an artificial sequence for increasing the methionine content of soy and a plant expression vector thereof, which solve the problem of the poor stability of the prior methods for increasing the methionine content of the soy in the prior transgenic technology. In the artificial sequence HSSP for increasing the methionine content of the soy of the invention, the sequence of the HSSP is shown as SEQ ID NO: 1. The plant expression vector of the artificial sequence for increasing the methionine content of the soy comprises the artificial sequence HSSP, wherein the upstream of the artificial sequence HSSP of the plant expression vector comprises an E12 enhancer sequence and a seed specific expression promoter PGY2, while the downstream comprises a Tnos terminator sequence. The technical scheme of the invention can be used for cultivating transgenic soy with high methionine content.

Description

technical field [0001] The invention relates to an artificial sequence for increasing soybean amino acid content and its plant expression vector. Background technique [0002] Methionine is a sulfur-containing essential amino acid, which is closely related to the metabolism of various sulfur-containing compounds in organisms. When methionine is lacking, it will cause loss of appetite, slow growth or no weight gain, kidney enlargement and liver iron accumulation, and finally lead to liver necrosis or fibrosis, so the human body needs to supplement a large amount of methionine from food. [0003] Soybean is an important source of plant protein, but the content of sulfur-containing amino acids in soybean protein is low, which seriously affects the nutritional quality of soybeans. Breeding soybean varieties with high content of sulfur-containing amino acids is a major problem to be solved in production. Although improving the ratio of essential amino acid codons through the tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/82
Inventor 朱延明柏锡才华纪巍李勇季佐军
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More