Supercharge Your Innovation With Domain-Expert AI Agents!

Method for synthesizing gene growing at constant temperature in double directions

A gene synthesis and isothermal technology, applied in the field of genetic engineering, can solve the problems of high cost, complicated operation, long synthesis cycle, etc., and achieve the effects of high success rate, simple operation and simple design

Inactive Publication Date: 2009-10-21
SHANGHAI QINGLAN BIOCHEM SCI & TECHCO
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to provide an improved gene synthesis method of isothermal bidirectional growth, which can overcome some shortcomings of complex operation, high cost and long synthesis cycle in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing gene growing at constant temperature in double directions
  • Method for synthesizing gene growing at constant temperature in double directions
  • Method for synthesizing gene growing at constant temperature in double directions

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0016] A gene synthesis method for isothermal bidirectional growth of the present invention is characterized in that: the gene synthesis method specifically comprises the following steps:

[0017] (1), design and synthesize the oligonucleotide chain for extension according to the target DNA sequence, or purify the synthetic oligonucleotide chain;

[0018] (2), the oligonucleotide chain obtained in step (1) is mixed in the reaction system, and add the mixed enzyme that has three kinds of activities of polymerase, ligase and restriction endonuclease, in the synergy of multiple enzymes Under the influence of isothermal bidirectional growth and extension reaction, the target DNA long chain is synthesized. The temperature of the synthesis process is between 25°C and 40°C, and the optimum temperature is 33°C.

[0019] Synthesize the target DNA long chain. If the synthetic yield is insufficient, PCR amplification can be performed, and the synthetic product or PCR product can be used...

Embodiment 1

[0043] Synthesis of a 412 base sequence in Example 1 Lambda exonuclease gene

[0044] The target synthetic product is a 412 base DNA sequence from the lambda exonuclease coding gene, as follows:

[0045] 5’-TCACAACGTGATAGCAAAACCCCGCTCCGGAAAGAAGTGGCCTGACATGAAAATGTCCTACTTCCACACCCTGCTTGCTGAGGTTTGCACCGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTGGCCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCTGTTTGAATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCTCCCGATGGTTTATGCAGCGACGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGGTGGTTTCGAGGCCATAAAGTCAGCTTACATGGCCCAGGTGCAGTACAGCATGTGGGTGACGCGAAAAAATGCCTGGTACTTTGCCAAC-3’

[0046] The polymerase used was Klenow exo-, the ligase was T4 DNA ligase, and the restriction enzyme was BtsI.

[0047] The gene synthesis process is as follows:

[0048] (1) Design and synthesize the oligonucleotide chain for extension according to the target DNA sequence, or purify the synthesized oligonucleotide chain.

[0049] The sequence for oligonucleotid...

Embodiment 2M13

[0062] A section in the M13 phage genome of embodiment 2

[0063] Synthesize a 227-base DNA sequence from M13 phage, the sequence is as follows:

[0064] 5’-GGCATTACGTATTTACCCCGTTTAATGGAAACTTCTCTCATGAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTTCGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGTGGGCGATGGTTGTTGTCATTGTCGGCGCAATA

[0065] The polymerase used was Klenow exo-, the ligase was T4 DNA ligase, and the restriction enzyme was BtsI.

[0066] The gene synthesis process is as follows:

[0067] (1) Design and synthesize the oligonucleotide chain for extension according to the target DNA sequence, or purify the synthesized oligonucleotide chain.

[0068] Oligonucleotide strand design.

[0069] The design of oligonucleotide chain is identical with embodiment 1, and all oligonucleotide chains are as follows:

[0070] segmented short sequence

[0071] name

sequence

M5

GGCATTACGTATTTACCCGTTTAATGGAAACTTC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for synthesizing gene growing at constant temperature in double directions. The method is characterized by comprising the following steps: (1) designing and synthesizing an oligonucleotide chain for extending or sublimated and synthesized oligonucleotide according to a target DNA sequence; (2) mixing the oligonucleotide chain obtained in the step (1) in a reaction system and adding mixed enzymes with three activities of polymerase, joining enzyme and restriction enzyme into the reaction system, growing at constant temperature in double directions under the synergic action of a plurality of enzymes, making an extending reaction and synthesizing the target DNA long chain. The invention has the advantages of high success ratio, simple design, simple operation, high degree of automation, and the like, thereby having potential low cost advantage and having potential application values to the development in the fields of gene synthesis popularization, biological engineering, biomedicine, information biology, and the like.

Description

Technical field: [0001] The invention relates to the technical field of genetic engineering, in particular to a gene synthesis method of isothermal bidirectional growth. Background technique: [0002] With the development of biotechnology and medicine, designing or modifying genes is getting more and more attention. Traditional gene amplification, cloning, recombination and mutation techniques can only obtain DNA sequences that exist in nature or are similar. To realize the free design of genes, the genes must be artificially synthesized. The artificial synthesis of genes includes two steps: one is to artificially splice chemically synthesized oligonucleotide chains by enzymatic methods to obtain longer sequences; the other is to further splice longer sequences based on longer sequences to obtain longer DNA sequences , until the desired length is reached. For shorter DNA sequences (<1kb), step 2 is generally unnecessary. In gene artificial synthesis, step one is the ke...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/34
Inventor 林继伟
Owner SHANGHAI QINGLAN BIOCHEM SCI & TECHCO
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More