Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Porphyra haitanensis molecular marker-assisted selection breeding method

A molecular marker-assisted, selective breeding technology, applied in botany equipment and methods, biochemical equipment and methods, plant cells, etc., can solve the problems of laver cultivation and breeding that are rarely used, so as to improve selection accuracy and reduce breeding Scale, the effect of shortening the breeding cycle

Inactive Publication Date: 2011-10-26
OCEAN UNIV OF CHINA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] With the rapid development of mariculture in recent years, molecular marker-assisted breeding technology has also been used in marine economic species, but it is rarely used in laver culture and breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porphyra haitanensis molecular marker-assisted selection breeding method
  • Porphyra haitanensis molecular marker-assisted selection breeding method
  • Porphyra haitanensis molecular marker-assisted selection breeding method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] In the following, growth rate and maturity traits are used as target traits for parental material selection, and growth rate and maturity traits are used as aggregation target traits for further illustration.

[0018] The microsatellite marker used in the present invention is except available microsatellite marker in the prior art, preferably adopts following screening method to screen and obtain the microsatellite marker of Porphyra laver:

[0019] 1 Construction of Microsatellite Enrichment Library

[0020] Genomic DNA of Porphyra zebra filaments was extracted by conventional methods, 10 μg was taken, and the genomic DNA was digested with restriction endonucleases Hae III and Afa I, digested at 37°C for 12 hours, and 500- Fragments of 1500bp size. Add adapters for ligation, the condition is 50ng 5'-end phosphorylated adapters (the adapter sequence is SEQ ID NO.15'pTAGTCCGAATTCAAGCAAGAGCACA3'; SEQ ID NO.2: 5'CTCTTGCTTGAATTCGGACTA3'), 1μg enzyme-digested fragment, 20U ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of porphyra haitanensis molecular breeding and specifically provides a method for establishing a cross breeding system with the use of porphyra haitanensismolecular marker-assisted selection. The method can quickly and effectively select strains of breed with excellent properties, shorten breeding process and provide a new breeding system for the development of dried purple seaweed breeding.

Description

technical field [0001] The invention belongs to the technical field of molecular breeding of algae laver, and in particular relates to a molecular marker-assisted selection breeding method of almanac laver. Background technique [0002] Porphyra belongs to Rphdophyta, Protoflorideophyceae, Bangiales, Bangiaceae, and Porphyra. It is one of the main cultured species of laver in my country, mainly distributed in Fujian and Zhejiang , Guangdong coastal, has extremely high nutritional value and economic value. At present, the laver breeding technology still adopts traditional selective breeding, mutation breeding and other methods, which makes the genetic basis of laver cultured varieties increasingly narrow, and some important cultivation traits such as yield, quality, high temperature resistance, and disease resistance are different to varying degrees. Lost, thereby limiting the development of laver aquaculture in my country. Hybrid breeding can accumulate and inherit the excel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/04A01H1/04A01H1/02A01G33/02C12Q1/68
Inventor 茅云翔孔凡娜王莉杨惠
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com