Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human-like collagen gene, homodirection tandem gene with different repeat numbers, recombinant plasmid having tandem gene and preparation method

A human-like collagen and recombinant plasmid technology, applied in the field of genetic engineering, can solve the problems of difficult product purification, imperfect processing and modification system, long production cycle, etc., to achieve easier success and avoid difficult primer design and condition exploration work , a feasible effect

Active Publication Date: 2008-06-18
JIANGSU JLAND BIOTECH CO LTD
View PDF5 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Generally speaking, low expression, long production cycle, difficult cultivation, and high cost are common problems when higher animal and plant cells are used as hosts, and cannot meet the requirements of industrialization and mass production
However, the pyrogens produced by the ubiquitous bacterial expression system make the expression product difficult to apply clinically; the expressed protein is often expressed in the form of inclusion bodies, which makes product purification difficult; the post-translational processing and modification system of the prokaryotic expression system is imperfect, and the biological low activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human-like collagen gene, homodirection tandem gene with different repeat numbers, recombinant plasmid having tandem gene and preparation method
  • Human-like collagen gene, homodirection tandem gene with different repeat numbers, recombinant plasmid having tandem gene and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] The base sequence of the human-like collagen gene of the present invention is as shown in SEQ ID NO: 1 in the sequence listing, namely:

[0032] agaggtccacccggtgagccaggtaacccaggttctccaggaaaccaaggtcaacctggaaacaagggttctcctggaaacccaggtcaacctggtaacgagggacaaccaggtcaacctggtcaaaacggtcaaccaggtgagcctggatctaacggtcctcaaggttcccaaggtaacccaggtaagaacggtcaaccaggttctccaggttcccaaggttctcctggaaaccaaggttctccaggtcaaccaggtaacccaggtcaacctggagagcaaggtaagccaggtaaccaaggtccagccggtggttaaagaa

[0033] The nucleic acid length is 322bp, named Gel.

[0034] combine figure 1 , the present invention contains the above-mentioned recombinant plasmid of human-like collagen gene. The human-like collagen gene Gel was cloned into the SmaI site of plasmid pUC57, and the resulting recombinant plasmid was named pUC57Gel. The results of EcoRI single-digestion electrophoresis of the recombinant plasmid pUC57Gel are shown in the appendix figure 1 Lane 2, where lanes 1 and 5 are DNA molecular weight standard DL150...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a human-like collagen gene, a same direction serial gene thereof with different repeat numbers, a recombined plasmid containing the serial gene and a preparation method. The base sequence of the human-like collagen gene Gel of the present invention is shown as SEQ ID NO: 1 in a sequence list, and the serial gene with different repeat numbers and the recombined plasmid containing the serial gene with different repeat numbers are obtained by the external enzyme digestion and the joint of the gene. The present invention is a complete novel sequence, and the length is greatly less than natural human collagen gene, which realizes the operation simplification at the molecular level and is easier to realize the gene engineering bacteria fermentation production of the collagen. The human-like collagen gene Gel also contains the characteristic of the natural human collagen gene, and corresponding human-like collagen expressed by the human-like collagen gene Gel can be provided with the good characteristic of the natural human collagen gene. The preparation method is just the simple external enzyme digestion connection reaction and the prokaryotic transformation and sieving with mature technology, which realizes the series connection of the target gene with any repeat number.

Description

a technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a human-like collagen gene, a tandem gene of the gene with different repeat numbers, a recombinant plasmid containing the tandem gene, and a preparation method of the recombinant plasmid. Two background technology [0002] Collagen (also known as collagen) is the most abundant protein family in animals. Collagen has strong biological activity and biological function, can participate in cell migration, differentiation and reproduction, and makes connective tissue have mechanical strength. At the same time, collagen can also promote cell growth, and has hemostatic, biocompatibility and biodegradation properties. Based on these characteristics, collagen has a wide range of applications in medical and health fields such as burns, trauma, corneal diseases, health care, beauty, orthopedics, hard tissue repair, wound hemostasis, drug delivery, and sustained rele...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/67C07K14/78C12N15/63C12N15/69
Inventor 杨树林高力虎李新柱储卫华钮小松沈薇孟广荣唐红玉
Owner JIANGSU JLAND BIOTECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More