Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method for broad spectrum bacterium host green fluorescence protein expression carrier

A technology of green fluorescent protein and expression vector, applied in the field of microbiology

Inactive Publication Date: 2008-05-07
YANGZHOU UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Therefore, there is currently no expression vector that can express foreign genes in all types (including wild type) of E. coli, let alone a broad-spectrum expression vector that can be expressed in a variety of host bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for broad spectrum bacterium host green fluorescence protein expression carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] 1. Amplification of Amp promoter

[0027] Primers were designed according to the Amp promoter sequence, and Pvu II and BamH I restriction sites were introduced into the upstream and downstream primers respectively. The sequences of the upstream and downstream primers are:

[0028] CGCAGCTGGACGTCAGGTGGCACTTT, CGGGATCCACTC

[0029] TTCCTTTTCAATATTAT.

[0030] A small amount of plasmid pcDNA3 was extracted as a template to amplify the Amp promoter, and the 50μl PCR amplification system included 5μl 10× buffer, 2mmol / L Mg 2+ , 200μmol / L dNTPs, 200nmol / L forward and reverse primers, 1ng pcDNA3, 2.5U LA Tag DNA polymerase. The PCR program for 30 cycles is 94°C / 30s (the first cycle is 5min), 55°C / 30s, 72°C / 20s (the last cycle is 5min). The amplified products were analyzed by electrophoresis on 1% agarose gel and recovered and purified.

[0031] According to the instructions of the DNA Ligation Kit from TaKaRa Company, the amplified Amp promoter was T-cloned, that is, conne...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method for broad spectrum bacteria host green fluorescent protein expression vector, belonging to microbiology field. The technical proposal is that an Amp promoter is connected with a green fluorescent protein structural gene by a PCR amplified ampicillin resistance gene, and a broad spectrum type prokaryotic expression vector is obtained to start the green fluorescent protein expression. The expression vector of ampicillin resistance gene is used to construct the broad spectrum type GFP expression vector, which can widely affect the bacteria. The constructed vector expression to GFP prohibits the limitation of bacterial types and species, and bacterial growing environment; once the constructed GFP expression vector is transformed into the bacteria cells, the constructed GFP expression vector plays a role and expresses GEP, which widely extends the application field.

Description

technical field [0001] The present invention relates to the field of microbiology. Background technique [0002] Green fluorescent protein (GFP) is an ideal tracer marker, which has been widely used in biotechnology, cell biology, transgenic animals, environmental engineering, microbiology and other fields. However, to express foreign proteins (including GFP) in specific host cells at present, expression vectors compatible with the host cells must be used. For prokaryotic expression systems, Escherichia coli is a widely used host strain for expressing foreign genes. The promoter types used in prokaryotic expression vectors mainly include promoters based on the lac operon, T7 phage promoters, and lambda phage PL promoter, alkaline phosphatase phoA promoter, etc. The vectors containing these promoters need to meet specific induction conditions when expressing foreign proteins, and also need specific genotype Escherichia coli as the host bacteria for foreign gene expression. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/74C12N15/11C12N15/66
Inventor 李国才朱立天王晓红王劲松焦红梅季明春龚卫娟潘兴元
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com