Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Ankylosing spondylitis pathopoiesia correlation gene IRS-1 mutant gene, detecting method and reagent kit thereof

A technology related to ankylosing spondylitis and disease-causing genes, applied in anti-inflammatory agents, gene therapy, genetic engineering, etc., can solve problems such as diagnosis of ankylosing spondylitis without laboratory diagnostic reagents

Inactive Publication Date: 2008-05-07
古洁若 +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, in addition to judging ankylosing spondylitis from clinical symptoms and imaging data, there is no laboratory diagnostic reagent for the definitive diagnosis of ankylosing spondylitis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ankylosing spondylitis pathopoiesia correlation gene IRS-1 mutant gene, detecting method and reagent kit thereof
  • Ankylosing spondylitis pathopoiesia correlation gene IRS-1 mutant gene, detecting method and reagent kit thereof
  • Ankylosing spondylitis pathopoiesia correlation gene IRS-1 mutant gene, detecting method and reagent kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] AS family members were collected nationwide (8 AS patients, 18 non-patients), 97 sporadic AS patients and 122 healthy controls were screened. All patients were diagnosed by rheumatologists and met the New York criteria revised in 1994. The family map was constructed using Cyrillic 2.0 software. After analyzing the pedigree of the family, the following characteristics can be found: 1) There are patients in three consecutive generations, and they are passed on continuously. 2) There are both female and male patients, and the chances of the disease are equal for both men and women. Therefore, it was found that the two families conformed to the autosomal dominant inheritance pattern.

[0041] See the experimental procedure figure 2 .

[0042] Selection of Microsatellite Loci and Design of Primers

[0043] 1. Selection of microsatellite loci for genome-wide scanning and primer design:

[0044] The microsatellite marker primers in the ABI company PRISMRLinkageMapping S...

Embodiment 2

[0068] Detection of mutation gene of ankylosing spondylitis-related gene IRS-1:

[0069] The kit for diagnosing the IRS-1 mutation gene, an ankylosing spondylitis-related gene, mainly includes:

[0070] PCR primers for amplifying the 2759-site gene fragment containing IRS-1, Taq DNA polymerase and corresponding buffer.

[0071] The PCR primers are as follows:

[0072] Upstream primer: IRS-1-F: CGGATGAGTATGGCTCCAGT

[0073] Downstream primer: IRS-1-R: ACCTCCAATGTCAGGAGAGC.

[0074] 1. Preparation of blood sample DNA of the subject to be tested

[0075] 1. Research objects: clinically all rheumatic patients with inflammatory low back pain, or patients with suspected ankylosing spondylitis.

[0076] 2. Genomic DNA extraction: using the modified Miller method

[0077] a. Take 3-5ml of sodium citrate or EDTANa2 anticoagulated whole blood (try not to use heparin for anticoagulation), and place it in a 50.0ml capped centrifuge tube;

[0078] b. Add 5-8 times the volume (about 4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an IRS-1 mutant to relative gene of ankylosing spondylitis pathogenesis, which comprises IRS-1 gene series and 2759C to G heterozygous mutation. The invention also discloses a method of detecting the IRS-1 mutant, which comprises the comparison between the nucleotide sequence from samples under testing and the sequence of IRS-1 normal gene and checking that mutating is arranged at 2750 situs of the IRS-1 gene and mutated into G from basic group C; the invention also discloses a kit detecting the IRS-1 mutant, which comprises a PCR primer designed at neighboring coding area aiming at IRS-1 gene or No. 2759 basic group of the IRS-1 gene and other components. The invention has the advantages of benefitting for further studying pathogenesis theory of ankylosing spondylitis, developing work of IRS-1 mutation screening for ankylosing spondylitis patients, providing relative information for reference for prenatal diagnosis of patients with family history, predicting, screening and assuring disease of family patients and sporadic patients and providing service for diagnosis and therapy for ankylosing spondylitis.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a method, a kit and a method for detecting the haplotype region where the pathogenic gene of ankylosing spondylitis (AS) is located and the pathogenicity-related IRS-1 mutation gene in the region. IRS-1 mutant gene. Background technique [0002] Ankylosing spondylitis belongs to the category of rheumatic diseases and is one of the seronegative spondyloarthropathies. At present, ankylosing spondylitis is a chronic disease with the same disease or HLAB 27 positive in the family history whose cause is not clear. The main lesion is the spine. Bending and walking activities are limited, and there may be eye, lung, muscle, and bone lesions in varying degrees, as well as autoimmune dysfunction, so it is also an autoimmune disease. [0003] Sun et al. isolated a cDNA in 1991, encoding a 160-185kD phosphotyrosine protein, which is considered to be involved in insulin signal transd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12Q1/68G01N27/447A61K48/00A61P19/00A61P29/00
Inventor 古洁若沈岩
Owner 古洁若
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com