High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use
A technology of glucagon and genetically engineered bacteria, applied in the field of bioengineering, can solve the problems of high price, high synthesis cost, difficult polypeptide technology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1 Construction of a genetically engineered bacterium expressing human glucagon-like peptide-1: a genetically engineered bacterium containing 1 to 16 single strings of SD-TrxA-His·Tag-EK-GLP-1-TAA. The TrxA is thioredoxin.
[0052] The first step of base sequence synthesis
[0053] According to the sequence: SD sequence-purification tag His·Tag-enterokinase EK site-human glucagon-like peptide-1, that is, GLP-1 gene-stop codon TAA, chemically synthesized base sequence with a length of 215bp, as follows ,
[0054] XbaI SD sequence
[0055] 5'-CC tctaga AATAATTTTGTTTAACTTTAAG AAGGAGA TATACATATGTCTGGA
[0056] Met Ser Gly
[0057] His·Tag BglII
[0058] TCAGGT CATCATCATCATCATCAT TCTTCT agatct GATGACGACGACAAG
[0059] Ser Gly His His His His His His His Ser Ser Gly Thr Asp Asp Asp Asp Lys
[0060] EK
[0061] CATGCCGAAGGCACCTTTACCAG...
Embodiment 2
[0072] Example 2 Construction of a genetically engineered bacterium expressing human glucagon-like peptide-1: containing 1 to 16 single strings of P T7 - Genetically engineered bacteria of SD-His·Tag-EK-GLP-1-TAA.
[0073] The first step of base sequence synthesis
[0074] With the first step of embodiment 1;
[0075] The second step is to construct a genetically engineered bacterium containing the DNA sequence of a single string of GLP-1 genes
[0076] The DNA sequence of the single string of GLP-1 gene is P T7 -SD-His·Tag-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 obtained in the first step by double digestion with two restriction endonucleases, the two restriction endonucleases The enzymes are XbaI and EcoRI, the small fragments are purified and recovered, the plasmid pET-32a(+) is double-digested with the same two restriction enzymes, the large fragments are purified and recovered, and the small fragments and large fragments recovered above are connected to obt...
Embodiment 3
[0079] Example 3 Construction of a genetically engineered bacterium expressing human glucagon-like peptide-1: containing 1 to 16 single strings of P T7 - Genetically engineered bacteria of SD-TrxA-His·Tag-EK-GLP-1-TAA.
[0080] The first step of base sequence synthesis
[0081] With the first step of embodiment 1;
[0082] The second step constructs the genetically engineered bacterium containing the DNA sequence of the single string GLP-1 gene
[0083] The DNA sequence of the single string of GLP-1 gene is P T7 -SD-His·Tag-TrxA-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 obtained in the first step by double digestion with two restriction endonucleases, the two restriction endonucleases The endonuclease is KpnI / EcoRI, the small fragment is purified and recovered, the plasmid pET-32a(+) is double-digested with the same two restriction endonucleases, the large fragment is purified and recovered, and the small and large fragments recovered above are connected to obtain...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com