Supercharge Your Innovation With Domain-Expert AI Agents!

5′ triphosphate oligonucleotide with blunt end and uses thereof

a triphosphate oligonucleotide and oligonucleotide technology, applied in the field of immunotherapy and drug discovery, can solve the problems that the mechanism of viral rna recognition by rig-i is not yet fully elucidated, and achieve the effect of enhancing the type i ifn-inducing activity of an oligonucleotide and reducing the type i ifn-inducing activity of an oligonucleo

Active Publication Date: 2016-08-09
UNIVERSITY OF BONN
View PDF269 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0070]The present invention also provides a method for reducing the type I IFN-inducing activity of an oligonucleotide, wherein the oligonucleotide has at least one blunt end and comprises at least 1 ribonucleotide at the 5′ end at the blunt end, wherein the blunt end bears a 5′ triphosphate attached to the most 5′ ribonucleotide, wherein the 5′ triphosphate is free of any cap structure, and wherein the blunt end is followed by a fully double-stranded section which is at least 19, preferably at least 21 base pair (bp) in length, comprising the step of 2′-O-methylating a nucleotide which is not the most 3′ nucleotide which base pairs with the most 5′ ribonucleotide bearing the 5′ triphosphate at the blunt end; preferably, the nucleotide to be 2′-O-methylated is the nucleotide immediately 5′ to the most 3′ nucleotide which base pairs with the most 5′ ribonucleotide bearing the 5′ triphosphate at the blunt end.

Problems solved by technology

Despite its pivotal role in anti-viral defense, the mechanism of viral RNA recognition by RIG-I is not yet fully elucidated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

RNA Oligonucleotides Bearing 5′ Triphosphate are Recognized by Different Receptors in Monocytes and PDCs

[0331]PDCs, MDCs and monocytes were all found to be able to respond to stimulation of RNA oligonucleotides bearing 5′ triphosphate (3pRNA) by producing IFN-α (data not shown). To identify the receptors involved in the recognition of 3pRNA in these different immune cell populations, in vitro transcribed 3pRNA (Table 1) were transfected into these cells in the presence and absence of chloroquine, a potent inhibitor of TLR7, TLR8 and TLR9-mediated nucleic aid recognition.

[0332]

TABLE 1RNA and DNA oligonucleotide sequences.namesequencetypeSEQ ID NOGA5′-pppGGGGGGGGGGGAAAAAAAAAAAA-3′RNA, in vitro transcribed1GFPs5′-pppGGGGCUGACCCUGAAGUUCAUCUU-3′RNA, in vitro transcribed2SynRNA5′-oHGGGGCUGACCCUGAAGUUCAUCUU-3′RNA, synthetic23pRNA5′-pppGGGGCUGACCCUGAAGUUCAUCUU-3′RNA, in vitro transcribed2CpG5′-GGGGGACGATCGTCGGGGGG-3′DNA, synthetic3(ppp: triphosphate; under lined letters: phosphorothioate li...

example 2

IFN-α Induction in Monocytes Strictly Requires the Presence of a 5′ Triphosphate

[0337]Synthetic RNA oligonucleotides bearing 5′ monophosphate (Table 2) were transfected into purified primary human monocytes. An in vitro transcribed RNA bearing 5′ triphosphate was used as a positive control. The level of IFN-α secretion was determined 24 hours after transfection / stimulation.

[0338]

TABLE 2RNA oligonucleotide sequences.namesequencetypeSEQ ID NO27 + 0 s5′-OHAAGCUGACCCUGAAGUUCAUCUGCACC-3′RNA, synthetic427 + 0 a5′-OHGGUGCAGAUGAACUUCAGGGUCAGCUU-3′RNA, synthetic527 + 0 ds5′-OHAAGCUGACCCUGAAGUUCAUCUGCACC-3′RNA, synthetic3′-UUCGACUGGGACUUCAAGUAGACGUGGOH-5′27 + 2 s5′-OHGCUGACCCUGAAGUUCAUCUGCACCACUU-3′RNA, synthetic627 + 2 a5′-OHGUGGUGCAGAUGAACUUCAGGGUCAGCUU-3′RNA, synthetic727 + 2 ds5′-OHGCUGACCCUGAAGUUCAUCUGCACCACUU-3′RNA, synthetic3′-UUCGACUGGGACUUCAAGUAGACGUGGUGOH-5′3pRNA5′-pppGGGGCUGACCCUGAAGUUCAUCUU-3′RNA, in vitro2transcribedCpG-A5′-GGGGGACGATCGTCGGGGGG-3′DNA3(p: monophosphate; ppp: triph...

example 3

Blunt End Augments the Immunostimulatory Activity of Synthetic Double-Stranded Oligonucleotides Bearing 5′ Triphosphate

[0342]Since 3pRNA oligonucleotides are capable of inducing IFN-α production from PDCs via a TLR7-dependent pathway (see Example 1), in order to study RIG-1-dependent induction of IFN-α, RNA oligonucleotides (FIG. 3& Table 3) were transfected into purified monocytes, PDC-depleted PBMCs (PBMC-PDC) or chloroquine-treated PBMCs (PBMC+Chl).

[0343]The design and the designation of the RNA oligonucleotides are shown in FIG. 3 and the sequences of the oligonucleotides are shown in Table 3.

[0344]

TABLE 3RNA and DNA oligonucelotide sequencesNameSequence5′ endTypeSEQ ID NO3P-AAACACACACACACACACACACUUU3PRNA, syn8ivt3P-GGACACACACACACACACACACUUU3PRNA, ivt93P-GGACACACACACACACACACACUUU3PRNA, syn93P-CCACACACACACACACACACACUUU3PRNA,syn103P-UUACACACACACACACACACACUUU3PRNA,syn11HO-AAACACACACACACACACACACUUUOHRNA,syn8P-AAACACACACACACACACACACUUUPRNA, syn8AS A26AAAGUGUGUGUGUGUGUGUGUGUUGUOHRNA, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
dissociation constantaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The present invention provides an oligonucleotide which is capable of activating RIG-I and inducing an anti-viral, in particular, an IFN, response in cells expressing RIG-I. The present invention further provides an oligonucleotide which is capable of activating RIG-I and which has target gene-silencing activity. The oligonucleotide of the present invention has a double-stranded section of at least 19, preferably at least 21 bp, at least one 5′ triphosphate, and at least one blunt end which bears a 5′ triphosphate. The present invention further provides the use said oligonucleotide for inducing an anti-viral, in particular, an IFN, response in vitro and in vivo. The present invention additionally provides the use of said oligonucleotide for preventing and / or treating diseases or conditions such as infections, tumors / cancers, and immune disorders.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application is a 35 U.S.C. §371 National Phase Entry application of International Application No. PCT / EP2009 / 003621 filed on May 20, 2009, which designates the United States, and which claims the benefit of priority of European Application No. 08009406.3 filed May 21, 2008, European Application No. 08015261.4 filed Aug. 29, 2008, and European Application No. 08018243.9 filed Oct. 17, 2008; and which also claims the benefit of priority under 35 U.S.C. §119(e) of U.S. Provisional Application No. 61 / 076,986 filed Jun. 30, 2008; U.S. Provisional Application No. 61 / 082,431 filed Jul. 21, 2008; U.S. Provisional Application No. 61 / 092,825 filed Aug. 29, 2008; and U.S. Provisional Application No. 61 / 100,594 filed Sep. 26, 2008, the contents of each of which are incorporated by reference herein in their entirety.FIELD OF THE INVENTION[0002]The present invention relates to the field of immunotherapy and drug discovery. The present invention pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(United States)
IPC IPC(8): A61K31/713A61K48/00A61P31/12A61P37/04C07H21/00A61K31/7088C12N15/113C12N15/117
CPCC07H21/00A61K31/7088C12N15/117C12N15/1131C12N15/1135C12N2310/14C12N2310/17
Inventor HARTMANN, GUNTHERSCHLEE, MARTIN
Owner UNIVERSITY OF BONN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More