Recombinant yeast strain and IFN alpha-la interferon purifying process
A technology of interferon and yeast, which is applied in the field of purification of α-1a interferon, which can solve the problems of high production cost, large side effects, and low specific activity, and achieve good economic benefits, reduce costs, and shorten purification time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] 1. Construction of IFNα-1a interferon yeast engineering bacteria
[0028] (1) Materials:
[0029] 1. IFNα-1a gene
[0030] 2. pGAPZα-A, P. pastoris Strain GS115 (his4) were purchased from
[0031] Invitrogen, Australia.
[0032] (2) Method:
[0033] 1. Gene PCR amplification:
[0034] (1) Primer design: delete the Kex2 (Lys-Arg) site in the 5' end primer
[0035] The following Ste13 site (Glu-Ala-Glu-Ala) and the initiation codon ATG.
[0036] P1-5'G CTCGAG AAAAGA ATG TGTGATCTGCCTCAAACC3' ("ATG" is removed)
[0037] Xho I Lys-Arg (Kex2 site)
[0038] P2-5'G TCTAGA TCATTCCTTACTTCTTAAACT3'
[0039] wxya
[0040] (2) Thermal cycle: 95°C, 5'; 95°C, 30"→49°C, 30"→72°C, 60"72°C, 10' amplification for 30 cycles.
[0041] 2. PCR amplification product recovery and cloning:
[0042] (1) The IFNα-1a gene was amplified and electrophoresed to obtain a DNA band of about 521bp;
[0043] (2) The target fragment was recovered with a high-p...
Embodiment 2
[0048]Purification method of α-1a interferon: After constructing α-1a interferon yeast engineered bacteria (IFNα-1a / pGAPZα-A / GS115), store the strain at -80°C. Before fermentation, inoculate the plate to activate the strain, inoculate a single colony in YPD+Zeocin100 mg / L medium and ferment for 72 hours, collect the fermentation supernatant by centrifugation, adjust the pH to 4.0-5.0 with acetic acid, and pass through the CM Sepharose column layer Analysis, collect 0.4 mol / L sodium chloride elution peak, add ammonium sulfate to 30%, centrifuge to get supernatant, pass PhenylSepharose column chromatography, collect 10% ammonium sulfate elution peak, pass DEAE Sepharose column chromatography, collect The peak was eluted with 0.1 mol / L sodium chloride, and the protein peak was collected by Sephacryl S-200 column chromatography to obtain a stock solution of α-1a interferon with a purity greater than 95%.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap