TaqDNA polymerase mutant
A polymerase and nucleic acid technology, applied in the biological field, can solve problems such as the unsatisfactory effect of resistance to inhibition and the high amount of templates
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] The acquisition of embodiment 1-Taq 01 DNA polymerase mutant
[0057] In this embodiment, a CSR high-throughput screening system is first established, and a mutant library is obtained by error-prone PCR, and then the mutant library is subjected to emulsification PCR and the extension time and cycle number are reduced during the PCR process (see figure 1 ).
[0058] In the fifth round of the library, 6 clones were randomly selected, and the activity of the crude enzyme was detected by inducing the bacteria to produce crude enzymes, and the mutation was identified by sequencing. It was found that in this case, the wild-type bacteria could not amplify the 2500bp band and the The amplified band of Taq 01 indicates that it has excellent activity (see figure 2 ). Therefore, it was purified together with WT and E507K and tested for activity.
Embodiment 2
[0059] Embodiment 2-PCR detects mutant to SYBR Green Tolerance of I
[0060] The mouse genome was used as a template in PCR detection of the mutant's tolerance to SYBR Green I, and primers that could amplify 1kb DNA were designed. The primer sequence is F: gcagatagggaaatggggctcctga (SEQ ID NO: 3), R: tcagcaagacctgcgtaggcaacgg (SEQ ID NO: 4). Anti-tolerance was detected by the inhibition of Taq DNA polymerase by SYBR Green I. Set four SYBR Green concentration gradients of 0, 1:50, 1:25, and 1:12.5, respectively, and use Taq DNA polymerase and mutants to amplify a 1kb mouse genome fragment under these pressure conditions.
[0061] It was found that WT could not amplify the product or the amplified product band was weak under the condition of SYBR Green 1:50, while E507K and Taq 01 could amplify the product under the condition of SYBR Green 1:50 and the band was relatively weak. bright, and the Taq 01 mutant has a weak band under the condition of SYBR Green 1:12.5, while E5...
Embodiment 3-q
[0066] Example 3-qPCR two-step method detects rapid PCR and tolerance to SYBRGreenI activity
[0067] In the qPCR two-step detection method, the human cell genome was used as a template, and primers capable of amplifying 148bp DNA were designed. The primer sequence is F: aaagccgctcaactacatgg (SEQ ID NO: 5), R: tgctttgaatgcgtcccagag (SEQ ID NO: 6). SYBR Green I dye was used to detect product formation during qPCR. Different annealing times and template amounts were set during the qPCR two-step method.
[0068] The results showed that the Taq 01 DNA polymerase mutant, WT and E507K could amplify the product regardless of the amount of template when the extension time was 1 min, and the CT values were similar. But when the extension time was reduced to 10sec, WT could not amplify the product, but other E507K and Taq 01 could amplify the product. And among them, the Taq 01 mutant performed superiorly, and the CT value of the E507K mutant reported in the literature was about ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com