Method for judging aging degree based on gene mutation and DNA methylation characteristics
A technology of methylation and methylation rate, applied in the field of genetics, can solve the problems of RNA inability to transcribe, chromatin conformation change, protein inactivation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Taking mouse sperm experimental data as an example, technology detects depends on mammalian gene sequencing data and all genome methyl group sequencing data.
[0038] 1): Select 15 mice, sampled in mice in July and 199 (equivalent to 30 years old and 60 years old), and collect samples after collecting samples, each genome methylation sequencing and all genome methylation Sequencing, each sample sequence amount is 90g, using Illumina X-Ten sequencer PE150 sequencing technology;
[0039] 2): Data cleaning of the sequencing original drop-down data, remove the READS below the Q20, accounting for more than 10% or N base more than 50% of READS, removes the joint information in the sequencing segment, the joint information is as follows:
[0040] R1: agatcgaagagcaccgtctgaactccagtcac
[0041] R2: agatcgaagagcgtcgtgtaggguaagagatgta
[0042] 3): The sequencing data is compared by the mouse reference sequence MM10, and the READS compared with the comparison of mass> 30 in the comparis...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap