Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of polypeptide that improves plant amylose content, nucleic acid and application thereof

A polynucleotide and plant technology, applied in the fields of crop genetics, breeding and biotechnology, can solve problems such as increasing amylose content, and achieve the effect of increasing amylose content

Active Publication Date: 2021-11-26
SHANDONG SHUNFENG BIOTECH CO LTD
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is no report on increasing amylose content by mutating the waxy gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of polypeptide that improves plant amylose content, nucleic acid and application thereof
  • A kind of polypeptide that improves plant amylose content, nucleic acid and application thereof
  • A kind of polypeptide that improves plant amylose content, nucleic acid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0123] Example 1. Construction of gene editing vectors and screening of mutation sites

[0124] 1. Construct the ABE-nCas9 base editor targeting rice endogenous GBSS1 gene (such as figure 1 shown)

[0125] The ABE base editor can realize the base conversion of A / T->G / C within a certain sequence window range. The present invention uses the ABE-nCas9 base editor as a carrier to design sgRNA in the rice endogenous GBSS1 gene ( The sgRNA shown in Table 1) were respectively cloned into the ABE-nCas9 vector to form a base editor targeting the rice endogenous GBSS1 gene, and the amino acid encoded by the rice endogenous GBSS1 gene is shown in SEQ ID No.1.

[0126] Table 1 The sgRNA sequence targeting the rice GBSS1 gene

[0127] sgRNA ID guide-PAM sequence (5'-3') A-GBSS10 ATGCAGGAGGACGTCCAGAT (SEQ ID NO. 8)

[0128] 2. Genetic transformation of rice and identification of transgenic plants

[0129] The rice variety Xiushui 134 was used as the experimental m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a polypeptide, nucleic acid and application thereof for increasing the amylose content of plants, relates to mutant GBSS1 polypeptide, nucleic acid and application thereof, specifically, relates to mutant GBSS1 polypeptide, nucleic acid and application thereof in plant breeding, Specifically, the present invention provides a mutant GBSS1 polypeptide, and compared with the parent GBSS1 polypeptide, the mutant GBSS1 polypeptide corresponds to the 427th and / or 428th amino acid of SEQ ID NO.:1 Mutation occurs. The GBSS1 mutated plants have a very high amylose content, and have very broad application prospects in cultivating plants with high amylose content.

Description

technical field [0001] The invention belongs to the fields of biotechnology and crop genetic breeding, and relates to a polypeptide, nucleic acid and application thereof for increasing the amylose content of plants, in particular to a GBSS1 mutant protein and its method and application for increasing the amylose content of plants . Background technique [0002] Rice (Oryza sativa) is eaten by two-thirds of the world's population and is the main source of energy in the diet of at least half of them. Rice is a low-cost food that is easy and quick to prepare and is eaten with a variety of dishes. [0003] Rice is mainly composed of carbohydrates, mainly in the form of starch (90%) in the endosperm. Starch is widely used in food, paper and chemical industries. Starch can be divided into amylose and amylopectin according to the structure. Amylose is an essentially linear molecule in which the D-glucose units are linked by α-1.4 glycosidic linkages, while amylopectin contains ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/1051C12N15/8245C12Y204/01242
Inventor 张金山牛小牧
Owner SHANDONG SHUNFENG BIOTECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More