Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of loc663462 gene in pest control

A technology for preventing and controlling pests and genes, which is applied in the field of genetic engineering, can solve problems such as inedibility, discoloration and odor, and moldy odor of victims, so as to reduce the body length and width, the number of eggs laid and the hatching rate Effect

Active Publication Date: 2021-10-08
SOUTH CHINA NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to direct damage, the smelly glands on the body surface of the adult Tribetium chinensis can also secrete a stinky liquid containing the carcinogenic benzoquinone, causing the victim to have a musty smell, resulting in discoloration and odor, making it inedible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of loc663462 gene in pest control
  • Application of loc663462 gene in pest control
  • Application of loc663462 gene in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 The expression of the LOC663462 gene in different periods of the red beetle

[0040] The expression of the LOC663462 gene was detected in the whole worm of Trichobolus chinensis by quantitative PCR, and the quantitative primers were:

[0041] F': GCAGTTCAAAGCGCAAAGACA (SEQ ID NO: 4),

[0042] R': TTTCACCGGTTGAGAGACGG (SEQ ID NO: 5);

[0043] The internal reference gene is RP3, and the primer sequences are:

[0044] F': TCAAATTGATCGGAGGTTTG (SEQ ID NO: 6),

[0045] R': GTCCCACGGCAACATAATCT (SEQ ID NO: 7);

[0046] The detection period includes the 1st day of the egg stage (EggD1), the 4th day of the egg stage (EggD4), the 18th-20th day of the larval stage (L-D18~20), the 1st-5th day of the pupal stage (P1~5), 0.5-1 hour after adult eclosion (Ad 0.5-1h), 1-6 days after adult eclosion (Ad1-6).

[0047] Such asfigure 1 Shown is the expression graph of the LOC663462 gene in different periods of Tribetium chinensis. It can be seen that the expression level of t...

Embodiment 2

[0048] Example 2 Synthesis of LOC663462 gene dsRNA and its interference efficiency

[0049] The primers for synthesizing dsRNA are:

[0050] F': TAATACGACTCACTATAGGGATGGATACGATTGTGCAAGG (SEQ ID NO: 2),

[0051] R': TAATACGACTCACTATAGGGCCGTTTCCTGGTCAGTTAT (SEQ ID NO: 3);

[0052] Such as figure 2 Shown is the electropherogram of the synthesized dsRNA; from left to right, the first lane is the marker, the second lane is the DNA template used for the synthesis of dsRNA, and the third lane is the synthetic dsRNA, where the dsRNA is 500bp.

[0053] Using GFP dsRNA as a control, the primers for synthesizing GFP dsRNA are:

[0054] F': TAATACGACTCACTATAGGGTGGTCCCAATTCTCGTGGAAC (SEQ ID NO: 8),

[0055] R': TAATACGACTCACTATAGGGCTTGAAGTTGACCTTGATGCC (SEQ ID NO: 9);

[0056] According to the expression of the LOC663462 gene in different stages of Tribulus chinensis, the dsRNA injection was performed on the second day of the pupal stage. 200ng of dsRNA was injected into each of the...

Embodiment 3

[0058] Example 3 Effect of dsRNA of LOC663462 gene on the phenotype of Tribulus chinensis

[0059] Pupae emerged into adults 96 hours after dsRNA injection.

[0060] Observe the adults 1h after eclosion, such as Figure 4 As shown, no significant difference in appearance was found from the control group.

[0061] Observe the adults 1 day after eclosion, such as Figure 5 As shown, whether it is female or male, the appearance of the worms injected with LOC663462dsRNA is not significantly different from that of the control group, but the body size is slightly smaller than that of the control group.

[0062] The body length and body width of adults 1 day after eclosion are counted, and the results are as follows: Figure 6 As shown, it can be seen that among the males, the body size of wild-type (WT) and GFP dsRNA (dsGFP) injected is relatively similar, and the body length and body width of adults injected with LOC663462 dsRNA (dsLOC663462) are smaller than those injected with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering, in particular to the application of the LOC663462 gene in pest control. The present invention takes the LOC663462 gene as the target, designs dsRNA and injects it into the insect body, observes the influence on the reproduction and development of the insect, and finds that after the injection of the LOC663462 dsRNA, the body size of the insect becomes smaller, and the body length and body width are reduced to a certain extent; The number of eggs laid and the hatching rate decreased significantly after mating, and the LOC663462 gene affected the expression of the vitellogenin receptor VgR, affecting the recognition of vitellogenin by VgR, thereby affecting the entry of vitellogenin into the egg and participating in the maturation process of the egg. Insect reproduction, especially pest reproduction, plays an important role.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of the LOC663462 gene in pest control. Background technique [0002] Tribolium castaneum (Tribolium castaneum) belongs to the family Coleoptera and is distributed in tropical and warmer regions of the world. It is a kind of important worldwide stored grain pest with the characteristics of long life, fast reproduction and wide adaptability. In addition to directly causing damage, the odor glands on the body surface of the adult Tribetium chinensis can also secrete a stinky liquid containing the carcinogenic benzoquinone, causing the victim to have a musty smell, resulting in discoloration and odor that cannot be eaten. [0003] The red beetle is recognized as a representative insect that is easy to operate in experiments among Coleoptera insects, and it is also an easy-to-manage model insect in the study of genetic evolution and development. Its compl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113
CPCA01N63/60C12N15/113C12N2310/14C12Q1/6888C12Q2600/136C12Q2600/158C12Q2600/178
Inventor 朱子丹杨宏广童春梅邓惠敏
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com