Supercharge Your Innovation With Domain-Expert AI Agents!

A new strain of oosporus Ouderia microbes and its artificial cultivation method and application

A technology of artificial cultivation and bacterial strains, which is applied in mushroom cultivation, cultivation, plant cultivation, etc., can solve the problems of unstable quality, long growth cycle, and low yield, and achieve rich nutrients, short growth cycle, and high cultivation yield. Effect

Active Publication Date: 2022-03-25
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, Ouderia oospores are cultivated in a small amount in Shandong, Sichuan, Guangdong, Hunan, Jiangsu and Shanxi in my country, but the growth cycle is long, the yield is not high and the quality is not stable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A new strain of oosporus Ouderia microbes and its artificial cultivation method and application
  • A new strain of oosporus Ouderia microbes and its artificial cultivation method and application
  • A new strain of oosporus Ouderia microbes and its artificial cultivation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] On May 15, 2016, Hu Huiping, Su Guanlong and others conducted large-scale fungal resource collection and investigation in Meihua Mountain, Fujian, and collected a specimen of Ordella genus on humus, such as figure 1 and figure 2 and the original strain was obtained by tissue isolation, named Oudemansiella raphanipes HMGIM-W160136, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on April 26, 2020, and the address is: Xianlie Middle Road, Guangzhou 5th Floor, Building 59, No. 100 Courtyard, the preservation number is GDMCC NO: 61004.

Embodiment 2

[0062] The fruit bodies collected in the wild were sampled to obtain a pure PDA culture, and the pure culture was cultured with a serosol membrane-PDA medium to obtain fresh mycelia, dried at a low temperature (40° C.), ground with liquid nitrogen, and used. Ezup column-type fungal genome DNA extraction kit (Sangon Bioengineering (Shanghai) Co., Ltd.) was used to extract DNA genome, and the obtained DNA solution (DNA template) was refrigerated at -20°C for later use.

[0063] The ITS-PCR experiment was carried out with the universal primers ITS1 / ITS4 (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the fungal ribosomal intergenic region, and the amplification was carried out on a Biometra PCR machine. The composition of the reaction solution (50 μl in total) is as follows:

[0064]

[0065] ITS-PCR reaction conditions were: 94°C for 5 min; 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, 30 cycles; 72°C for...

Embodiment 3

[0068] Example 3 Artificial cultivation

[0069] The artificial domestication of Oudemansiella raphanipes HMGIM-W160136 collected in the field was carried out.

[0070] Taking Oudder oosporum HMGIM-W150719, HMGIM-MC-OR-0001, HMGIM-MC-OR-0002 and HMGIM-I170004 as controls, the growth period survey results of different strains are shown in Table 1, and the yield results of different strains are shown in Table 1. shown in Table 2.

[0071] 1. Culture medium (by weight percentage)

[0072] 1. Tissue isolation medium (comprehensive PDA):

[0073] Potato 200g / L, glucose 20g / L, agar 20g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 1.5g / L, VB 10.01g / L.

[0074] 2. Mother seed medium (Red Bengal medium):

[0075] Peptone 5g / L, glucose 10g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate (MgSO 4 . 7H 2 O) 0.5g / L, agar 20g / L, 1 / 3000 red Bengal solution 100mL, chloramphenicol 0.1g / L.

[0076] 3. Production of parent seed medium (enriched with comprehensive PD...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention relates to a new strain and its artificial cultivation method and use, in particular to a new strain of oospore Ouderia aurantia with a short growth cycle, its artificial cultivation method and its use. The new strain of Oudemansiella raphanipes of the present invention is collected from Meihua Mountain, Fujian, and is identified as Oudemansiella raphanipes, and the original strain is obtained by tissue isolation, named Oudemansiella raphanipes (Oudemansiella raphanipes) HMGIM-W160136 , and the deposit number is GDMCC NO: 61004. In summary, the present invention provides a new strain of Ouderia oosporus and its artificial cultivation method, which has a high protein content, crude polysaccharide content, potassium content and calcium content, and is a short growth cycle. , a new strain with high cultivation yield and rich nutrient content that has development prospects.

Description

technical field [0001] The invention relates to a new strain and an artificial cultivation method and application thereof, in particular to a new strain of Oomyces oosporum and an artificial cultivation method and application thereof. Background technique [0002] Edible fungi are a general term for large fungi with high protein and low fat. They are loved by consumers because of their high nutritional value and delicious taste. At present, the edible mushroom industry is developing rapidly. According to the statistics of the China Edible Mushroom Association, the output of edible fungi in my country reached 37.12 million tons in 2017, an increase of 3.21% over 2016, with an output value of 272.192 billion yuan. my country accounts for more than 75% of the global output. More than 20 million people. Edible fungi ranked fifth in the planting industry after grain, vegetables, fruit and oil, surpassing tea and sericulture, and have an important position. [0003] At present, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14
CPCA01G18/40A01G18/20A23L31/00A23L33/17A23L33/125A23L33/16A23V2002/00A23V2200/324A23V2200/30A23V2250/208A23V2250/54A23V2250/51A23V2250/1578A23V2250/16
Inventor 谢意珍杜娜胡惠萍雍天乔吴清平张智
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More