Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Carbohydrate binding domain specifically binding to carrageenan and its preparation and application

A technology of carbohydrates and binding domains, which is applied in the field of biotechnology and biochemical detection, can solve the problems of no carrageenan, etc., and achieve the effects of low cost, high accuracy, and simple preparation procedures

Active Publication Date: 2022-03-22
OCEAN UNIV OF CHINA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is that there is no research on CBM specifically binding carrageenan at present, which is not conducive to the in-depth research and development of carrageenan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbohydrate binding domain specifically binding to carrageenan and its preparation and application
  • Carbohydrate binding domain specifically binding to carrageenan and its preparation and application
  • Carbohydrate binding domain specifically binding to carrageenan and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1: Cloning, expression and acquisition of CBM CBP_Wa specifically binding to carrageenan in Escherichia coli

[0051] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers (5'-GTGCCGCGCGGCAGCCATATGAATTTAAAAGCTTCCAATAACA; 5'-GTGGTGGTGGTGGTGCTCGAGTTAAATGTCAAACTTTAAGGCTG) were designed according to the desired target gene. PCR was carried out using the whole genome as a template. The PCR reaction conditions were 95°C for 3 min, 95°C for 30 s, 52°C for 30 s, 72°C for 40 s, 25 cycles, and finally 72°C for 5 min to obtain the CBP_Wa gene fragment. NdeI and XhoI double-digest the target gene and pET28a(+) expression vector, and connect to form a recombinant plasmid. Heat shock treatment at 42°C transformed the recombinant plasmid into BL21(DE3) competent cells to form a recombinant strain. The expression was induced by isopropyl-β-D-thiogalactoside, t...

Embodiment 2

[0052] Example 2: Cloning, expression and acquisition of CBMCBP_Wa specifically binding to carrageenan in Pichia pastoris

[0053] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers (5'-AGCTTACGTAGAATTCAATTTAAAAGCTTCCAATAACAACAAATTTATTACTGTAGTAAGC; 5'-AATTAATTCGCGGCCGCTTAAATGTCAAACTTTAAGGCTGCATTTTTATTTATTTCCAT template) were designed according to the target gene, and the whole genome was used as the template in Example 1 Perform PCR to obtain the CBP_Wa gene fragment. Use EcoRI and NotI to double digest the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after SacI digestion, transform into Pichia pastoris GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH 8.0N,N-dihydroxy Re-suspend the bacteria in ethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, and culture it upside ...

Embodiment 3

[0054] Embodiment 3: the CBM CBP_Wa that specifically binds to carrageenan is cloned and expressed and obtained in Bacillus subtilis

[0055] Culture Wenyingzhuangia fucanilytica OF219 in 2216E medium until the end of the logarithm and extract the whole genome DNA, design the upstream and downstream primers according to the target gene (5'-CGTAGGATCCTCTAGAAATTTAAAAGCTTCCAATAACAACAAATTTATTTACTGTAGTAAGC; 5'-TAGGCGGGCTGCCCCGGGGttaAATGTCAAACTTTAAAGGCTGCATTTTTATTTATTT take the whole genome as the template in Example 1) PCR was carried out under the conditions to obtain the CBP_Wa gene fragment. XbaI and SmaI double-digested target gene and pHT43 plasmid, ligated to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90min, and spread on LB plate with chloramphenicol resistance. The positive clones were picked and inoculated in LB medium at 37°C, cultured for 12 hours, inoculated into the basic fermentation medium at 37°C at 3% inocul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a carbohydrate binding domain specifically binding to carrageenan, as well as its preparation and application. The present invention prepares a carbohydrate binding domain specifically binding to carrageenan, named CBP_Wa, and its amino acid sequence is SEQ ID NO.1. CBP_Wa has specific binding ability to carrageenan. This invention addresses the current lack of CBMs that specifically bind carrageenan. In addition, the present invention also provides methods and application examples based on CBP_Wa in qualitative, semi-quantitative, and visual observation of carrageenan, which demonstrates the good application potential of CBP_Wa in carrageenan research. CBP_Wa in the present invention is a novel tool for studying carrageenan and has practical significance.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a carbohydrate binding domain specifically binding to carrageenan and its preparation and application. Background technique [0002] Carrageenan is a class of sulfated polysaccharides present in red algae such as carrageen and Eucheuma. It is composed of repeating disaccharide units 1,3-O-β-D-galactopyranose and 1,4-O- 3,6-inside ether-α-D-galactopyranose residues alternately composed of linear chain polymers. The three most widely used carrageenans are κ-, ι- and λ-carrageenan. Carrageenan is widely used in food, chemical, pharmaceutical and other fields because of its good gelling, elasticity, transparency and other physical and chemical properties. It has been proved that carrageenan has a series of physiological functions such as anti-virus, anti-coagulation, anti-oxidation, and protection of gastric mucosa. [0003] Carbohydrate binding do...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/38C12N15/56G01N33/577G01N33/573
CPCC12N9/2468C07K14/43595G01N33/577G01N33/573C07K2319/00G01N2333/938
Inventor 常耀光梅轩玮申晶晶薛长湖张玉莹曹斯琦王玉明薛勇
Owner OCEAN UNIV OF CHINA
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More