Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for quickly detecting southern rice black-streaked dwarf virus based on RPA

A black-streaked dwarf virus, southern rice technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as few plant viruses, and achieve high sensitivity, simple operation methods, and high specificity. sexual effect

Inactive Publication Date: 2019-08-13
CHINA AGRI UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, RPA technology has emerged in medical diagnosis, detection and analysis of food pathogens and genetically modified crops, and biosafety, but there are few reports on plant virus detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly detecting southern rice black-streaked dwarf virus based on RPA
  • Method for quickly detecting southern rice black-streaked dwarf virus based on RPA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Embodiment 1, the RPA detection nucleotide primer combination screening of southern rice black-streaked dwarf virus

[0063] 1. Primer design

[0064] 1. A large number of sequence analyzes and comparisons were carried out to obtain 9 primers (as shown in Table 1) for detecting the southern rice black-streaked dwarf virus.

[0065] Table 1 is used to detect the RPA primer sequence of SRBSDV

[0066] Primer name Primer sequence (5'-3') SRBSDV-F1 AGATGAAGATCAAGATGAGTACGAACTAGC SRBSDV-F2 GATCAAGATGAGTACGAACTAGCTGGACTG SRBSDV-F3 AGATCAAGATGAGTACGAACTAGCTGGACTGT SRBSDV-F4 GAAGATCAAGATGAGTACGAACTAGCTGGACTG SRBSDV-F5 ATCAAGATGAGTACGAACTAGCTGGACTGTC SRBSDV-F6 AAATGTTGTCGTGAAGTTCCTGCTCAAATG SRBSDV-R1 GTCTTACGCAACGATGAACCTTTTCTCTATT SRBSDV-R2 CGGTCTTACGCAACGATGAACCTTTTCTCTA SRBSDV-R3 GTCTCGAATATTGGTCGTAACCGCCATAGT

[0067] 2. The 9 primers designed in step 1 are combined into 6 pairs of primer combina...

Embodiment 2

[0088] Embodiment 2, specificity

[0089] 1. Extract corn leaves infected with rice black-streaked dwarf virus (RBSDV), corn leaves infected with maize chlorotic mottle virus (MCMV), corn leaves infected with sugarcane mosaic virus (SCMV), infected with cucumber mosaic virus (CMV) The total RNA of maize leaves, maize leaves infected with brome mosaic virus (BMV) and maize yellow dwarf virus (MYDV) were reverse transcribed into cDNA.

[0090] 2. Extraction of total DNA from healthy maize leaves.

[0091] 3. Take the total RNA extracted from maize leaves infected with Southern rice black-streaked dwarf virus (SRBSDV), and reverse transcribe it into cDNA.

[0092] 4. Get the cDNA or total DNA obtained in steps 1, 2 and 3, use the cDNA or total DNA as a template, and use primers SRBSDV-F and primers SRBSDV-R to form an RPA reaction (see Example 1 for the reaction method) Steps 2 and 3 of the second part in . Set to use ddH 2 0 as a negative control group for the template.

[...

Embodiment 3

[0094] Embodiment 3, sensitivity

[0095] 1. Take the total RNA extracted from maize leaves infected with southern rice black-streaked dwarf virus (SRBSDV), and reverse-transcribe it into cDNA (cDNA concentration is 692.5ng / μL).

[0096] 2. Dilute the cDNA obtained in step 1 step by step with a 10-fold gradient, respectively 10 0 、10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 A total of 7 dilutions, the corresponding concentrations are 692.5ng / μL, 69.25ng / μL, 6.925ng / μL, 6.925×10 - 1 ng / μL, 6.925×10 -2 ng / μL, 6.925×10 -3 ng / μL, 6.925×10 -4 ng / μL.

[0097] 3. Using the cDNA with different gradient dilutions in step 2 as a template, use a primer pair consisting of primer SRBSDV-F and primer SRBSDV-R to carry out RPA reaction (see steps 2 and 3 in the second part of Example 1 for the reaction method).

[0098] Set to use ddH 2 0 as a negative control group for the template.

[0099] The result is as figure 2 shown.

[0100] The results show that the method has a sensi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly detecting southern rice black-streaked dwarf virus based on RPA. A primer pair is composed of two primers shown in the sequence 1 and the sequence 2 in a sequence list. The invention protects the method for detecting the southern rice black-streaked dwarf virus by using the primers. The method does not depend on precise test instruments, the operation method is simple, the primers can effectively amplify the target gene, and the method is high in specificity and higher in sensitivity; early quick detection of the virus can be achieved, and the method has an important significance for preventing and controlling occurrence and prevalence of the virus.

Description

technical field [0001] The invention relates to the field of plant protection, in particular to a method for rapidly detecting southern rice black-streaked dwarf virus based on RPA. Background technique [0002] Southern rice black-streaked dwarf virus (SRBSDV) is a new species belonging to group 2 of the genus Fijivirus in the family Reoviridae, and is persistently phenotyped by white-backed planthoppers. spread. The virus not only causes rice black-streaked dwarf disease, but also infects maize causing rough dwarf disease and severe yield loss. Rice, corn, wheat, barley and other grass weeds are the main natural hosts. Viruses are confined to the phloem after infecting plants. Infected rice plants are severely dwarfed and cannot be jointed. The leaves are dark green in color and the leaf tips are curled. At the jointing stage, there are anaerobic fibrous roots and high-node tillers on the stem nodes of the diseased plants. Strips of milky white or dark brown appear on t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q1/701C12Q2521/507C12Q2522/101
Inventor 范在丰马文娣田逸英焦志远任彬元杨普云周涛
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com