Sorghum transcription factor SbWRKY45 gene and recombinant vector containing same, and expression method of gene

A technology of transcription factor and recombinant vector, applied in chemical instruments and methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problems that have not yet been reported on WRKY gene research.

Inactive Publication Date: 2019-07-05
GUIZHOU UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, WRKY transcription factors exist in a variety of plants, including Arabidopsis, rice, etc., but so far, there has been no research report on WRKY genes in sorghum at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sorghum transcription factor SbWRKY45 gene and recombinant vector containing same, and expression method of gene
  • Sorghum transcription factor SbWRKY45 gene and recombinant vector containing same, and expression method of gene
  • Sorghum transcription factor SbWRKY45 gene and recombinant vector containing same, and expression method of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Acquisition and Analysis of Sorghum Transcription Factor SbWRKY45 Gene

[0034] According to the reported protein sequence of the rice WRKY4 gene, blastP searched the sorghum genome database (https: / / phytozome) to find the sorghum homologous gene SbWRKY45 (gene number is Sb08g005080, and its nucleotide sequence is shown in SEQ ID NO.1). Search the NCBI database with the SbWRKY45 protein (its amino acid sequence is shown in SEQ ID NO.2), download the WRKY genes in other species, and use the MEGA 7.0 software to construct a no root phylogenetic tree, by figure 1 It can be seen that SbWRKY45 and millet (Setaria italica) WRKY are clustered together and have the closest relationship. It can be known that SbWRKY45 gene is a sorghum transcription factor.

Embodiment 2

[0035] Example 2: Construction and Identification of Sorghum Transcription Factor SbWRKY45 Gene Recombination Vector

[0036] 1. Extract sorghum RNA and reverse transcribe cDNA

[0037] The sorghum BTx623 material was taken, the total RNA at the seedling stage was extracted with an RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and cDNA was obtained by reverse transcription with a reverse transcription kit (Promega).

[0038] 2. Using cDNA as a template to amplify the SbWRKY45 gene;

[0039] Primers were designed to amplify the SbWRKY45 gene using cDNA as a template.

[0040] Primers are as follows:

[0041] Upstream primer: SbWRKY45-F: GC GGATCC ATGGCAGCGGCGGCG is underlined as the BamHI restriction site;

[0042] Downstream primer: SbWRKY45-R:CG CTCGAG The underline of CTACTCATCAGCATAAATGTCCGT is the XhoI restriction site;

[0043] The upstream and downstream primers are shown in SEQ ID NO.3 and 4 respectively.

[0044] The PCR amplification s...

Embodiment 3

[0049] Example 3: Induced expression of SbWRKY45 protein

[0050] 1. Obtain the recombinant prokaryotic expression strain of SbWRKY45

[0051] The single clone successfully sequenced in Example 2 was selected and inoculated into 50ug / mL kanamycin liquid medium, cultured overnight at 37°C and 200rpm, and the pET-28a - The SbWRKY45 recombinant expression vector was extracted, and the recombinant expression vector plasmid was transformed into Escherichia coli expression strains BL21(DE3), JM109(DE3), BL21(DE3)pLysS, Tuner(DE3), Rosetta(DE3), and the expression of SbWRKY45 protein was detected.

[0052] 2. Cultivate the activated strain overnight

[0053] The above-mentioned recombinant prokaryotic expression strains were activated by culturing overnight. For example, transfer BL21(DE3), JM109(DE3), Tuner(DE3) strains to 50ug / mL kanamycin liquid medium, transfer Rosetta(DE3), BL21(DE3)pLysS strains to 50ug / mL In mL kanamycin+50ug / mL chloramphenicol liquid medium, cultivate the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a sorghum transcription factor SbWRKY45 gene. A nucleotide sequence of the gene is as shown in SEQ ID NO.1. The invention further discloses a protein of a sorghum transcriptionfactor SbWRKY45 gene code, and an amino acid sequence of the protein is as shown in SEQ ID NO.2. The invention further discloses a recombinant vector containing the sorghum transcription factor SbWRKY45 gene and an expression method. A sorghum homologous gene SbWRKY45 is acquired from a sorghum gene database by a protein sequence of a rice WRKY4 gene, the overall length of the gene is 1005bp, a prokaryotic expression vector is built according to the gene, the gene is purified by a protein purification system, a base is provided for further research of a protein crystal structure and biological characteristics by a purification result, and bases are provided for improving the disease resistance of sorghum by a gene editing method.

Description

technical field [0001] The invention relates to a sorghum transcription factor SbWRKY45 gene, a recombinant vector and an expression method thereof, belonging to the field of biotechnology. Background technique [0002] Sorghum (Sorghum bicolor (L.) Moench), also known as water millet and chestnut, is an important cereal crop with strong resistance to adversity. It is an important raw material, and it is also a kind of animal husbandry crop that has been widely used in recent years. Sorghum has a long history of cultivation in my country, and it was not cultivated on a large scale before the founding of the People's Republic of China. It was not until the 1970s, with the development of economy and society, that my country gradually paid attention to and cultivated sorghum on a large scale. Sorghum is a short-day C4 plant. Compared with other energy crops, sorghum has more obvious photosynthetic efficiency and higher yield advantages, so it is known as a "high-energy crop". ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/70
CPCC07K14/415C12N15/70
Inventor 谢鑫蒋君梅任明见李向阳孙涛
Owner GUIZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap