Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe, kit and application for detecting soybean mosaic virus based on RPA technology

A soybean mosaic virus and technical detection technology, applied in the biological field, can solve problems such as limiting the scope of use, and achieve the effects of accurate diagnosis, strong specificity and high sensitivity

Pending Publication Date: 2019-06-28
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology involves making certain DNA sequences that cannot easily crossbreed with another organism by modifying them or adding special chemicals called reagents during researching processes. These modifications make it difficult if there're any harmful agents like bacteria causing food poisonings from crops grown outside their natural habitats. By designing these modified genome sequence templates and detecting this modification through various techniques such as PCR (polymerase chain reaction) analysis, mass spectrometry, fluorescence spectroscopy, etc., we have developed an assay system capable of quickly identifying different types of soilborne plant viruses without damaging themselves.

Problems solved by technology

Technological Problem: Current Methods For Detection Of MOSCOPY Virus Using LABP Signals To Existing Solutions These Known Protocols They require multiple reactions or complicated procedures like incubating samples before testing their ability to cause harmful symptoms such as reduced growth rates or even death due to bacterial disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, kit and application for detecting soybean mosaic virus based on RPA technology
  • Primer, probe, kit and application for detecting soybean mosaic virus based on RPA technology
  • Primer, probe, kit and application for detecting soybean mosaic virus based on RPA technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] RPA primers, probes, and RPA kits for detecting soybean mosaic virus include:

[0033] 1. Design and synthesis of RPA primers and probes

[0034] Referring to the conserved sequence of the CP gene of soybean mosaic virus in GenBank (genbank accession number is JF833015), select the specific conserved region (position 8681-8840 in JF833015), and design RPA primers and probes. All primers and probes were synthesized by Shanghai Handsome Biotechnology Co., Ltd., and the base sequences of the primers and probes are shown below.

[0035] Upstream primer (SEQ ID NO.1):

[0036] 5'-AAGGAAGATGAATCTTCCAATGGTTGAAGGGAA-3';

[0037] Downstream primer (SEQ ID NO.2):

[0038] [5'BIOTIN]ATCAAGTTCATATTCATCTTTGACTGCATTGTA-3';

[0039] Probe (SEQ ID NO.3): [5'FAM]GTTTAGACCACTTGCTTGAGTATAAAC

[0040] CTAAT[THF]AAGTTGATTTATTCAA[3'a phosphate];

[0041] Among the probes, THF is tetrahydrofuran, FAM is fluorescein, phosphate is phosphate group; BIOTIN is biotin.

[0042] Fragment sequen...

Embodiment 2

[0051] The method for rapidly detecting soybean mosaic virus using the above-mentioned kit specifically comprises the following steps:

[0052] (1) Recombinase polymerase amplification (RPA) reaction:

[0053] Using TwistAmp TM Prepare 50 μL real-time RPA reaction system with nfo kit, add 2.1 μL of upstream primers with a concentration of 10 μM, 2.1 μL of downstream primers with a concentration of 10 μM, 0.6 μL of probes with a concentration of 10 μM, 29.5 μL of Rehydration Buffer, and 12.2 μL of distilled water. In a 0.2 mL reaction tube of dry enzyme, add 1 μL cDNA template and 2.5 μL MgAc with a concentration of 280 mM into the reaction tube, amplify at 39° C. for 20 minutes to obtain an amplified product.

[0054] (2) Detection of amplification products:

[0055] After the amplification reaction, draw 2 μL of the RPA amplification product and mix with 98 μL of HybriDetect Assay Buffer solution to form a mixture, then draw 10 μL of the mixture and add it dropwise to the l...

Embodiment 3

[0056] The sensitivity experiment of embodiment 3 kits of the present invention

[0057] The experimental process is as follows: the soybean mosaic virus cDNA is subjected to RPA amplification reaction, and the dilution ratio of 1 and 10 is added to each amplification reaction. -1 , 10 -2 , 10 -3 The soybean mosaic virus cDNA was used as a template. After the reaction finishes, carry out lateral flow chromatography test strip detection according to soybean mosaic virus rapid detection method of the present invention, and detection result is as follows: figure 2 As shown, it can be seen that the method can detect soybean mosaic virus cDNA (nucleic acid concentration 1.333ng / μL) diluted 100 times in the reaction system, and the detection sensitivity is very high.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe, a kit and application for detecting soybean mosaic virus based on an RPA technology. A base sequence of an upstream primer is shown as SEQ ID NO.1, the basesequence of a downstream primer is shown as SEQ ID NO.2, and the base sequence of the probe is shown as SEQ ID NO.3. Besides the primers and the probes, the kit also comprises one or more of a flow measurement chromatography test strip, a flow measurement chromatography test strip buffer solution, an RPA enzyme, an RPA buffer solution, a magnesium acetate solution, ddH2O and a reference substance.The invention also discloses a method for detecting the soybean mosaic virus. Specific primers and the probes are designed based on a soybean mosaic virus CP gene, and the kit is prepared by a recombinase polymerase amplification-flow chromatography method. The sensitivity is high, the specificity is strong, the diagnosis is accurate, the whole detection process only needs 30 minutes, and the judgment of the result is extremely simple and convenient.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com