Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for identifying pig backfat thickness based on rs80995809 locus genotyping and its application

A genotype and backfat technology used in the field of genetic engineering

Active Publication Date: 2019-06-25
BEIJING COMPASS BIOTECHNOLOGY CO LTD
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the continuous improvement of people's lives and the development of modern breeding technology, traditional breeding methods can no longer meet people's demand for pork quality, and it is particularly important to breed breeding pigs with high production performance, healthy meat quality and excellent flavor.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying pig backfat thickness based on rs80995809 locus genotyping and its application
  • Method for identifying pig backfat thickness based on rs80995809 locus genotyping and its application
  • Method for identifying pig backfat thickness based on rs80995809 locus genotyping and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1. A method for identifying live pig backfat thickness based on the rs80995809 locus

[0056] 1. Screening of rs80995809 site

[0057] 1. Extraction of DNA from pig ear tissue samples

[0058] Genomic DNA was extracted from ear tissue samples of 1758 Large White pigs from Sichuan Tianzhao Pig Industry Co., Ltd. and Chifengjia Breeding Pig Ecological Technology Group Co., Ltd. respectively.

[0059] 2. Amplification of the target fragment

[0060] (1) PCR amplification

[0061] Using the genomic DNA obtained in step 1 as a template, PCR amplification was performed using primers F1 and R1, respectively, to obtain PCR amplification products. The primer sequences are as follows:

[0062] F1: CCTGTTGTGGTGCAGTGAAG (sequence 2);

[0063] R1: GTGAGGCCAGGGATCAAACC (SEQ ID NO: 3).

[0064] (2) Recovery, purification and sequencing of PCR products

[0065] The agarose gel purification and recovery kit is used to recover and purify the PCR amplification product to ob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying pig backfat thickness based on rs80995809 locus genotyping and its application. The method is used to detect whether the genotype of the rs80995809 locus in a pig individual is a GG genotype, a TT genotype or a GT genotype, according to the genotype of individual pigs, the backfat thickness of pigs is determined: the backfat thickness of the pigs with GG genotype is thicker than the backfat thickness of the pigs with GT genotype, and the backfat thickness of the pigs with GT genotype is greater than the backfat thickness of the pigs with TT genotype. The experiment proves that the rs80995809 locus has a significant effect on the pig backfat thickness, the selected SNP can be used as a molecular genetic marker, the numbers of trait loci thatare related or closely linked to the backfat thickness can be looked for, which can directly perform genotype selection or marker-assisted selection for large white pigs, and the breeding of dominantvarieties of the large white pigs can be accelerated.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a method for identifying pig backfat thickness based on rs80995809 site genotyping and its application. Background technique [0002] Pigs are the first of the six livestock, and the pig industry occupies an important position in the world, especially in China's national economy. The proportion of pork in many meat products has remained at about one-third, and it is one of the more popular meats. With the continuous improvement of people's life and the development of modern breeding technology, traditional breeding methods can no longer meet people's demand for pork quality. It is particularly important to cultivate breeding pigs with high production performance, healthy meat quality and excellent flavor. [0003] Thickness of backfat is one of the important carcass traits of pigs, which reflects the level of pork fat content. A low value of backfat thickness indi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888
Inventor 刘继强
Owner BEIJING COMPASS BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com