Supercharge Your Innovation With Domain-Expert AI Agents!

Development and application of purple gene marker for controlling capsicum green fruit

A pepper genome and pepper technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of identification and screening of unapplied anthocyanins.

Active Publication Date: 2019-04-16
CHINA AGRI UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2005, Yelena Borovsky et al. cloned the An2 gene homologously through the tomato EST tag to obtain the pepper A gene, which encodes the R2R3MYB transcription factor, which is a regulatory gene that regulates the anthocyanin synthesis process. It is located on chromosome 10 of pepper, and obtained a A marker that completely co-segregates with gene A (F: 5'GGAGTNAGGAAAGGTNCATGG 3'; R: 5'GTCATCTTTGTCTAATGTGTTTGTG 3'), but has not been used in the identification and screening of anthocyanin content or purple traits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Development and application of purple gene marker for controlling capsicum green fruit
  • Development and application of purple gene marker for controlling capsicum green fruit
  • Development and application of purple gene marker for controlling capsicum green fruit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1, the acquisition of molecular marker CAPS-78-708

[0054] The female parent of this experiment: Ziguiren (18C2458), Qingguozi (an inbred line purified from selfing of the variety "Ziguiren" bred by Syngenta, Fanghuanxiang, key points of cultivation techniques for colored sweet peppers in solar greenhouses[J]. Rural Science and Technology 2013 (4): 20-20); male parent: CM334 (18C3375), green fruit (CM334 pepper high-generation inbred line, Xu Xiaowan et al., resistance genetic analysis of pepper blight resistance resource 'CM334'[ J]. Plant Protection 2011 (05) 32-33); Obtaining F by hybridization 1 , and then self-cross to get F 2 Isolated population 18C2459, 639 F 2There were 458 plants with purple green fruit and 181 plants with green green fruit in the generation population. The Chi-square test showed that the genetic segregation conformed to the Mendelian segregation ratio, and the purple green fruit trait of pepper was single-gene dominant inheritance. ...

Embodiment 2

[0084] Example 2, Application of Molecular Marker CAPS-78-708

[0085] The present invention uses 40 capsicum inbred varieties (Table 2) with known green fruit color phenotypes to verify the applicability of the molecular marker CAPS-78-708. The inbred varieties used can be obtained from the Solanaceae research group of the Department of Vegetables, College of Horticulture, China Agricultural University.

[0086] 17C604, Zijing No. 1 high-generation inbred line, Jiang Haikun et al. Breeding of protected cultivation purple pepper variety "Zijing No. 1" [J]. Anhui Agricultural Science Bulletin 2017,23(17)50-51

[0087] 17C613, Jiyu No. 2 inbred line, Liu Jianbing, etc., a new pepper variety - Jiyu No. 2 [J]. Vegetables 2004, (04) 8-9

[0088] 17C628, Oasis Zhenla inbred line, Sun Zhigang, etc., a new dry and fresh pepper variety Oasis Zhenla[J].2003(7)57-58

[0089] 17C630, Yangjiao 2 inbred line, Qi Jianbo et al. Breeding of a new early-maturing pepper variety Yangjiao 2[J]. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses development and application of a purple gene marker for controlling capsicum green fruit. The application of a substance for detecting the genotype of the SNP-78-708 locus of acapsicum genome in identifying or assisting in identifying the color of the capsicum green fruit or the application of the substance for detecting the genotype of the SNP-78-708 locus of the capsicumgenome in preparing a product for identifying or assisting in identifying the color of the capsicum green fruit are provided. The SNP lotus is the 193360134 lotus of the chromosome 10 of the capsicumgenome. Experiments prove that a molecular marker is found at about 37.8.3 Mb downstream the chromosome 10 A gene, and dCAPs marker CAPS-78-708 is designed according to the molecular marker, and thecolor of the capsicum green fruit can be detected.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the development and application of a gene marker for regulating the purple color of capsicum green fruit. Background technique [0002] Anthocyanins are an important class of water-soluble secondary metabolites that widely exist in nature, mainly distributed in the flowers and fruits of crops, but also commonly found in the leaves, stems and seeds of crops. Pepper (Capsicum annuum L.) is an important agricultural crop in the world and is a good source of vitamins, carotenoids and flavonoids. The chlorophyll and carotenoids in the pepper fruit make it appear green, yellow, orange and red fruits. Among the cultivated capsicum germplasm resources, there are several purple fruit genotypes, which may be an important source of anthocyanins. However, the purple pigmentation appears only in the unripe fruit. [0003] Improving stress resistance and fruit nutritional quality of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/156C12Q2600/13
Inventor 沈火林刘金秋
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More