Wingless signal channel genes related with regeneration of severed limbs of American cockroach and applications of dsRNA of same

A technology for regenerating related genes, Periplaneta americana, applied in the field of genetic engineering, can solve difficult problems such as prevention and control, and achieve the effect of avoiding environmental pollution

Active Publication Date: 2018-11-16
MEIZHOU HUASHENG GUANGMEI BIOTECHNOLOGY CO LTD
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The larvae of Periplaneta americana have a strong ability to regenerate appendages (legs and antennae, etc.), have a strong ability to survive, and are extremely difficult to control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wingless signal channel genes related with regeneration of severed limbs of American cockroach and applications of dsRNA of same
  • Wingless signal channel genes related with regeneration of severed limbs of American cockroach and applications of dsRNA of same
  • Wingless signal channel genes related with regeneration of severed limbs of American cockroach and applications of dsRNA of same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Screening of Wingless signaling pathway genes related to amputated limb regeneration

[0018] 1) Preparation of RNA-Seq samples

[0019] Perform operations such as selection, amputation, and collection of leg tissues on Periplaneta americana. The specific amputation operation method is as follows: amputate the joint of the hind limb trochanter and leg joint on one side, and keep the complete base joint and trochanter. Femur, tibia and tarsi cut off together ( figure 1 ), the legs on the other side were all reserved for the control experiment. The basis for the amputation treatment method was that the inventors found that the trochanter played a very important role in the regeneration of the amputated limb. When the trochanter was cut off, it could not regenerate a normal Morphological and functional new legs; samples were collected at various time points (1dpa, 3dpa, 5dpa, 7dpa and 10dpa (day postamputation, dpa)) after amputation ( figure 1 ); then collect ...

Embodiment 2

[0021] Example 2 Synthesis and acquisition of gene dsRNA targeting Wingless signaling pathway

[0022] 1) Design of Wg, Arr and Dsh gene dsRNA primers

[0023] Based on the sequences of Wg, Arr and Dsh genes obtained in this study, the dsRNA design website E-RNAi (https: / / www.dkfz.de / signaling / e-rnai3 / ) was used to target the genes Wg, Arr and Dsh The entire open reading frame sequence was copied and pasted into the website, and the optimal dsRNA targeting sequence was obtained by screening the design parameters. Select the best amplification primer sequences generated by the website, and the dsRNA primers targeting the Wg gene are Wg.T7F: TAATACGACTCACTATAGGAGACGGCGTTCATACGC (SEQ ID No.7) and Wg.T7R: TAATACGACTCACTATAGGTCCGGGTTGTAGGGTTTCA (SEQ ID No.8); The dsRNA primers of the Arr gene are respectively Arr.T7F: GGATCCTAATACGACTCACTATAGGAACGGCACTCATACTGGACC (SEQ ID No.9) and Arr.T7R: GGATCCTAATACGACTCACTATAGG TTTGTTGCTGGTCTTTGTCG (SEQ ID No.10); the dsRNA primers targeting t...

experiment example 1d

[0027] Experimental example 1 In vivo injection of dsRNA affects the regeneration of severed limbs of Periplaneta americana

[0028] In order to verify the functions of the screened Wingless signaling pathway and Wg, Arr and Dsh genes in the process of limb regeneration in Periplaneta americana, the method of dsRNA injection into the newly amputated Periplaneta americana was used. The main principle is to use The gene expression interference function of dsRNA is used to verify the function of the gene, and the injection of CK that does not target any gene of Periplaneta americana is used as a negative control for dsRNA treatment. The general process is as follows: first select the newly casted Periplaneta americana larvae (d0), continue to cultivate for one day to adapt to the surrounding environment, then inject it with dsRNA for the first time (d1), and 24 hours later, treat one side of the Periplaneta americana larvae. Perform amputation operation (d2), retain the complete ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses Wingless signal channel genes related with the regeneration of severed limbs of American cockroach and applications of dsRNA of the same. The genes are Wg, Arr, and Dsh. The nucleotide sequence of Wg is represented by SEQ ID No.1; the nucleotide sequence of Arr is represented by SEQ ID No.2; and the nucleotide sequence of Dsh is represented by SEQ ID No.3. Through design, dsRNA of the genes related with the regeneration of severed limbs of American cockroach is targetedly silenced so as to control American cockroach.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to genes related to regeneration of Wingless signaling pathway of Periplaneta americana amputated limbs and application of dsRNA thereof. Background technique [0002] Cockroaches are native to Africa, and their living places are humid, warm, and dark; they like to hide in hidden crevices; their activity time is concentrated at night, so it is difficult for humans to eliminate their populations. Periplaneta americana is a relatively common cockroach. It is an omnivorous insect. It can eat sour, sweet, bitter, spicy and salty food, insect carcasses, etc., and prefers to eat sweets. It can survive for many days without water and food. At the same time, the American cockroach is very destructive, damages clothes, and spreads diseases. It is a common household hygiene pest. The larvae of Periplaneta americana have extremely strong appendage (legs and antennae, etc.) regen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/12C12N15/113A01N57/16A01P7/04
CPCA01N57/16C07K14/43563C12N15/113C12N2310/14
Inventor 任充华李胜
Owner MEIZHOU HUASHENG GUANGMEI BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products