Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for changing the feeding property of silkworm and its application

A silkworm, feeding technology, applied in the field of biology, genome editing

Active Publication Date: 2021-09-10
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are no related genes reported in silkworm

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for changing the feeding property of silkworm and its application
  • A method for changing the feeding property of silkworm and its application
  • A method for changing the feeding property of silkworm and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the cloning of hestia gene

[0050] The genome sequence of the target gene hestia is as follows (SEQ ID NO: 9, wherein the underlined sequence is an exon sequence, and the non-underlined sequence is an intron sequence):

[0051] ATGTCACCACCGCTAGTCCATATCAATACATTTGTTCAACCCAAGCAAAGTACACTGTAGACAAAAGTA TCAAAGTTTTTTATAATATGTAGTTTTTCTTAGGCGTTAATAGGTTGCCTATTATATCATCGAAACATGTGTATAC AATTCCTTCTATAATTTATACTTTCGTACTAATGTGTGTACTAAATTTTTTCGGGTTTGATTCTGTCTCATTATCTA TCATGAGTTTGAACCTTGTATTACATATCTTATGTTCCTTCCTTGGTATGTTTTTTTTGGAAGAGAATGCGCCTGTAT TATTCAGAGCTCTGTAAGTTTGATATTTGCATCGGATGCAGACCAATAACTGCACAAGGTTCCAGTAAACTTGTAAT TCAGACTTGCATTATAAATGTTTTGATAGCTTTGGTGTTTATTGTGCCGAATTCACTTCAGATTCTAATCAAACCAG TTATATATTTGCTTCCCATGCACGCCTTTGTGTCGTTCGAAGTGCATTATTATGGCCACCTTCTCAATTTACTTATC CCGCGTTTACATTTAATAAACTATTACATGGAATCCTCATTAACTACCACAAGCGATAAAAGGGAGTCGAGTGTACT GAAACATGTTATTTTTATTTAAATATTATAATAAGGAATCGAACTGTCAAATGAAAAAATTTATGGATCTTTATTATA TTATCGTAGAATTCTTACAGATATCTTA...

Embodiment 2

[0059] Embodiment 2, the selection of sgRNA target (TS) and the synthesis of sgRNA

[0060] The present invention uses the CRISPR / Cas9 system to knock out the hestia gene, and screens out a 23bp sgRNA recognition target (TS) located in exon 1 after extensive selection and testing of the gene sequence. Schematic diagram of the structure of the silkworm hestia gene and its target (TS) sequence as shown in figure 1 shown.

[0061] The sequence of the sgRNA recognition target is as follows:

[0062] 5'-GGATAAGTAAATTGAGAAGGTGG-3' (SEQ ID NO: 1).

[0063] sgRNA framework sequence (SEQ ID NO:11):

[0064] GNNNNNNNNNNNNNNNNNNNNN GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT

[0065] Wherein, the underlined part is the sgRNA targeting sequence.

[0066] According to the screened target (TS), the following primers sgF and sgR were synthesized:

[0067] sgF:

[0068] TAATACGACTCACTATAGGATAAGTAAATTGAGAAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG ...

Embodiment 3

[0073] Embodiment 3, the acquisition of Cas9 mRNA

[0074] The template plasmid used to synthesize Cas9 mRNA is pTD1-Cas9 (Yueqiang Wang, Zhiqian Li, JunXu, Baosheng Zeng, lin ling, Lang You, Yazhou Chen, Yongping Huang*, and Anjiang Tan* .The CRISPR / Cas System mediates efficient genome engineering in Bombyxmori. Cell Research 23(12):1414-6.2013). The nucleotide sequence of the plasmid is shown as SEQ ID NO: 8, the first ATG is a start codon, and the last TAG is a stop codon. A nuclear localization signal precedes the stop codon.

[0075] The pTD1 vector contains the T7 promoter, 5'-UTR and 3'-UTR sequences, and the ORF of the Cas9 gene is connected between the 5'-UTR and 3'-UTR sequences, so pTD1-Cas9 can be used as a template for in vitro transcription of Cas9 mRNA. The pTD1-Cas9 vector was linearized with Not I restriction endonuclease, and the gel was collected and purified as a template for Cas9 mRNA synthesis. Use mMESSAGEmMACHINE T7 kit to transcribe mRNA in vitro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for changing the feeding property of silkworm and its application. The invention destroys the gene structure of the silkworm hestia gene by fixed-point targeting, affects its normal feeding behavior, and promotes the feeding habit of the silkworm to change from oligophagous to omnivorous. This invention solves the breeding mode of sericulture production relying solely on mulberry leaves, and provides a new way of thinking for large-scale silkworm breeding.

Description

technical field [0001] The invention belongs to the field of biotechnology and the field of genome editing, and relates to a method and application for knocking out the hestia gene of the silkworm by using the CRISPR / Cas9 system to change the feeding property of the silkworm. Background technique [0002] Insects are the biological species with the largest variety and the largest number in the animal kingdom. The diversity of insect species is closely related to the differentiation of their feeding habits. According to the range of insect food, they are divided into polyphagous, oligophagous and monophagous. According to the nature of insect food, they are divided into several categories such as herbivorous, carnivorous, scavenging, and omnivorous. Herbivorous and carnivorous insects generally eat live plants and animals respectively, while scavenging insects eat dead or separated animals and plants, and omnivorous insects eat both plants and animals. In the long-term evo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/90A01K67/033
CPCA01K67/0339A01K2207/05A01K2217/058A01K2227/706A01K2267/02C07K14/43586C12N15/113C12N15/902C12N2310/10C12N2310/11C12N2310/14C12N2310/141
Inventor 谭安江牛宝龙计东风黄勇平张忠杰
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com