Screening kit for metastatic screening of papillary thyroid micro carcinoma
A technology for papillary carcinoma and thyroid gland, applied in the direction of microbial determination/inspection, instruments, measurement devices, etc., can solve the problem of lack of transcriptomics, and achieve the effect of avoiding excessive treatment, reducing psychological burden, and reducing economic burden.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 The relationship between the expression level of Trpc5 and the status of papillary thyroid microcarcinoma
[0021] 1. Pathological collection
[0022] The PTMC cases who underwent the first operation from December 2016 to May 2018 in West China Hospital of Sichuan University were collected. Before the operation, all signed the informed consent for specimen retention. Those who met the above conditions were routinely collected the pathological tissue specimens of surgical resection, and intraoperative thyroidectomy. Within 15 minutes of excision of the gland lobe where the cancer foci are located, the cancer foci and normal tissues were taken in separate tubes and filled with liquid nitrogen, and the patient information was registered in detail to make a record. A few months later, a pathological examination was performed to determine whether the lymph node had high metastasis or no metastasis, and were strictly selected for inclusion. The expression levels of ...
Embodiment 2
[0046] Embodiment 2 Composition of the kit for detecting Trpc5 of the present invention and its use method
[0047] 1. PCR detection kit
[0048] 1. Composition of the kit
[0049] Test kit (50 people):
[0050] component
volume
upstream primer
0.5ul(10μM)
downstream primer
0.5ul(10μM)
2×PCR Enzyme Mix
10μL
dd water
to a total volume of 20 μL
[0051] The Trpc5 primer sequences are as follows:
[0052] Forward: TCCTGTTTCCCATGCTGTCT
[0053] Reverse: GCCCCTGTACATGAAGGTCT.
[0054] 2. How to use the kit
[0055] The tissue stored in liquid nitrogen was taken out, placed on ice for 5 minutes to soften, crushed with a tissue homogenizer, weighed, and 1 ml of TRIZOL was added per 100 mg of tissue. Add 0.2 ml of chloroform to each sample lysed with 1 ml of TRIZOL reagent, and cap the tube tightly. After vigorously shaking the tube by hand for 15 seconds, incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 120...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap