Supercharge Your Innovation With Domain-Expert AI Agents!

SSR (Simple Sequence Repeat) marker related to length character of cucumber fruits and application of SSR marker

A fruit and cucumber technology, which is applied in the fields of genetic engineering and molecular biology, can solve the problems of different QTL numbers and positions, lack of anchor markers, and failure to achieve fine mapping of fruit length-related genes, so as to solve the problems of low reliability and identification. Convenient, locus-accurate results

Active Publication Date: 2018-10-09
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies have been conducted on cucumber fruit length (Kennard&Havey, 1995; Serquen et al, 1997; Fazio et al, 2003; Yuanet al, 2007), and the melon length QTLs detected in these reports are between 4 and 6, However, due to the different test materials used, the number and location of QTL are also different, and the same anchor markers are lacking, and the fine mapping of fruit length-related genes has not been realized.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SSR (Simple Sequence Repeat) marker related to length character of cucumber fruits and application of SSR marker
  • SSR (Simple Sequence Repeat) marker related to length character of cucumber fruits and application of SSR marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] The major QTL loci and linked molecular markers for cucumber fruit length were obtained by the following methods:

[0027] 148 plants of F 2 Progeny single plant.

[0028] Using the SLAF-seq method to analyze the parents and 148 strains of F 2 High-throughput simplified genome sequencing was carried out in the next generation, and a total of 7 linkage groups of cucumber were obtained from the analysis. The sequencing generated 10.76Gb of raw data, and the average sequencing depth of the parents was 53.48×, F 2 The average sequencing depth of the generation was 7.74×, and a total of 1800 SNP markers were developed, and the first high-density SNP genetic map of cucumber was constructed.

[0029] F 2 F 2:3 Families, planted F in spring 2013 and autumn 2014 2:3 Family, used for statistics of fruit length traits. Plant 10 plants in each family number, select a commercial melon and a mature melon for each plant, and measure the length of its fruit. The measurement stand...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SSR (Simple Sequence Repeat) marker related to a length character of cucumber fruits and application of the SSR marker and belongs to the field of plant molecular breeding. The invention discloses a molecular marker SSR05572 which is tightly interlocked with a length gene of the cucumber fruits for the first time; sequences of forward and backward primers of the marker are as follows: 5' GCAAACCATAAGTTTCCCCA 3' and 5' GATCGATATTGCAACGAATTACA 3'. In BC4-S2 constructed by cucumbers with a long-cucumber variety and cucumbers with a short-cucumber variety, the primers SSR05572F / SSR05572R can be amplified in a long-cucumber strain to obtain a 204bp product, can be amplified in a short-cucumber strain to obtain a 191bp product, and can be amplified in a heterozygosis strain to obtain a product with two stripes including 204bp and 191bp; the primers can be tightly interlocked with the length gene of the fruits. The molecular marker, which is tightly interlocked withthe length gene of the cucumber fruits, provided by the invention can be used for positioning the length gene of the cucumber fruits or carrying out molecular marker assisted breeding. The molecular marker has important theory and practice guiding significance of accelerating a genetic improvement process of cucumber varieties and improving the breeding selection efficiency.

Description

technical field [0001] The invention relates to genetic engineering and molecular biology, belongs to the field of molecular genetic breeding, provides SSR markers related to cucumber fruit length and application thereof, which can be used in molecular marker-assisted selective breeding of cucumber fruit length traits to improve breeding efficiency. technical background [0002] Cucumber (Cucumis sativus L.2n=2x=14) belongs to Cucurbitaceae Melon, an annual vine herb, and is one of the top ten vegetable crops in the world. my country's cucumber planting area and total output rank first in the world, but my country's cucumber output per unit area and export volume are lower than many countries. One of the key reasons for this contrast is the variety of high-quality cucumber varieties, especially Cucumber varieties suitable for protected cultivation are relatively scarce. Molecular-assisted selection can shorten the breeding cycle and improve breeding efficiency, and selection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 娄群峰曹蕾杨康魏庆镇
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More