Application of FtsHi5 gene of arabidopsis thaliana in regulation and control of development of chloroplast of arabidopsis thaliana
A technology of Arabidopsis thaliana and chloroplasts, applied in the field of genetic engineering, can solve problems such as embryo lethality and embryonic developmental defects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Embodiment 1: Construction and identification of FtsHi5 interference strain
[0022] 1.1 Vector construction
[0023] 1) Amplifying the FtsHi5 fragment of the target gene: using the cDNA of Col-0 as a template, amplifying the target fragment 1; the target fragment 1 is located at positions 157-587 of SEQ ID NO:1.
[0024] The primer sequences are as follows (5'→3'):
[0025] RNAi-FtsHi5-F: CGACTCTAGCCTCGAGTGCCCATTAGAGGCTGCTTT;
[0026] RNAi-FtsHi5-R:ACCAATTGGGGTACCGCAACCTCTCCATTTTCCTTTCT AACT;
[0027] The PCR reaction system is shown in Table 1:
[0028] Table 1 PCR reaction system (50μL)
[0029] components
Dosage
2×Primer STAR Mix
25 μL
RNAi-FtsHi5-F (10μM)
2.5μL
RNAi-FtsHi5-R (10μM)
2.5μL
cDNA
2μL
wxya 2 o
18μL
[0030] PCR amplification program:
[0031] 98°C for 10s; 98°C for 10s, 55°C for 5s, 72°C for 1min / kb (26 cycles); 72°C for 10min; store at 4°C.
[0032] PCR product recovery: ...
Embodiment 2
[0071] Embodiment 2: the mensuration of chlorophyll content and chloroplast ultrastructure observation
[0072] The wild-type Arabidopsis Col-0 and the interference line dex:RNAi-FtsHi5 (#1, #2, #6) grown for 2 weeks in the MS medium induced by adding and not adding DEX (concentration: 5 μmol / L) ) of chlorophyll content. Depend on figure 2 It can be seen that by measuring the chlorophyll content of wild-type Arabidopsis Col-0 and the interference strain dex:RNAi-FtsHi5 (#1, #2, #6) when adding and not adding DEX, it was found that the transcriptional expression of FtsHi5 was destroyed or down-regulated, Leaf chlorophyll content decreased. Depend on image 3 It can be seen that the chloroplast ultrastructure of dex:RNAi-FtsHi5#6 plants was observed by transmission electron microscopy. Compared with the control group, FtsHi5 transcription was down-regulated in the chloroplasts of the interference plants induced by DEX (30 μmol / L) for 7 days and 14 days. After expression, th...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com