Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of FtsHi5 gene of arabidopsis thaliana in regulation and control of development of chloroplast of arabidopsis thaliana

A technology of Arabidopsis thaliana and chloroplasts, applied in the field of genetic engineering, can solve problems such as embryo lethality and embryonic developmental defects

Inactive Publication Date: 2018-08-10
SOUTH CHINA AGRI UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, knockout of FtsHi2, FtsHi4, and FtsHi5 resulted in defects in embryonic development, similar to the phenomenon of embryonic lethality caused by knockout of FtsH12

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of FtsHi5 gene of arabidopsis thaliana in regulation and control of development of chloroplast of arabidopsis thaliana
  • Application of FtsHi5 gene of arabidopsis thaliana in regulation and control of development of chloroplast of arabidopsis thaliana
  • Application of FtsHi5 gene of arabidopsis thaliana in regulation and control of development of chloroplast of arabidopsis thaliana

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: Construction and identification of FtsHi5 interference strain

[0022] 1.1 Vector construction

[0023] 1) Amplifying the FtsHi5 fragment of the target gene: using the cDNA of Col-0 as a template, amplifying the target fragment 1; the target fragment 1 is located at positions 157-587 of SEQ ID NO:1.

[0024] The primer sequences are as follows (5'→3'):

[0025] RNAi-FtsHi5-F: CGACTCTAGCCTCGAGTGCCCATTAGAGGCTGCTTT;

[0026] RNAi-FtsHi5-R:ACCAATTGGGGTACCGCAACCTCTCCATTTTCCTTTCT AACT;

[0027] The PCR reaction system is shown in Table 1:

[0028] Table 1 PCR reaction system (50μL)

[0029] components

Dosage

2×Primer STAR Mix

25 μL

RNAi-FtsHi5-F (10μM)

2.5μL

RNAi-FtsHi5-R (10μM)

2.5μL

cDNA

2μL

wxya 2 o

18μL

[0030] PCR amplification program:

[0031] 98°C for 10s; 98°C for 10s, 55°C for 5s, 72°C for 1min / kb (26 cycles); 72°C for 10min; store at 4°C.

[0032] PCR product recovery: ...

Embodiment 2

[0071] Embodiment 2: the mensuration of chlorophyll content and chloroplast ultrastructure observation

[0072] The wild-type Arabidopsis Col-0 and the interference line dex:RNAi-FtsHi5 (#1, #2, #6) grown for 2 weeks in the MS medium induced by adding and not adding DEX (concentration: 5 μmol / L) ) of chlorophyll content. Depend on figure 2 It can be seen that by measuring the chlorophyll content of wild-type Arabidopsis Col-0 and the interference strain dex:RNAi-FtsHi5 (#1, #2, #6) when adding and not adding DEX, it was found that the transcriptional expression of FtsHi5 was destroyed or down-regulated, Leaf chlorophyll content decreased. Depend on image 3 It can be seen that the chloroplast ultrastructure of dex:RNAi-FtsHi5#6 plants was observed by transmission electron microscopy. Compared with the control group, FtsHi5 transcription was down-regulated in the chloroplasts of the interference plants induced by DEX (30 μmol / L) for 7 days and 14 days. After expression, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an FtsHi5 gene of arabidopsis thaliana in regulation and control of development of chloroplast of arabidopsis thaliana, and relates to the technical field of genetic engineering. According to the application, an interference vector of the FtsHi5 gene of the arabidopsis thaliana is constructed, and wild-type arabidopsis thaliana is transfected; the obtained FtsHi5 interference mutant shows yellowing and dwarfness when DEX is added, the chlorophyll content is reduced, and a thylakoid structure in the chloroplast is damaged. Experiments prove that the FtsHi5gene of the arabidopsis thaliana participates in the regulation and control of the development of the chloroplast, thus being capable of regulating and controlling the development of the chloroplast.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of an Arabidopsis thaliana FtsHi5 gene in regulating the development of Arabidopsis chloroplasts. Background technique [0002] Chloroplasts are semi-autonomous organelles commonly found in terrestrial plants, algae, and some protists, and are the site of photosynthesis. Plant photosynthesis is the material basis for the survival and development of almost all organisms. Therefore, the study of chloroplast development and regulation mechanism will help to better understand the regulation mechanism of photosynthesis. Chloroplast is an important organelle in plants. Although its development and regulation mechanism have been widely concerned by researchers, due to its complexity, there are still many regulatory molecular mechanisms that are still unclear. [0003] FtsH (Filamentation Temperature-Sensitive H) is a type of ATP-dependent metalloprotease wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N9/50A01H5/00A01H6/20A01H6/46A01H6/60A01H6/82A01H6/54
CPCC12N9/63C12N15/8261
Inventor 朱国辉李思慧汪婷席悦彭新湘
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com