Method for producing melittin
A technology of melittin and carrier, applied in the field of biological reagent invention, can solve the problems of high melittin activity, cell membrane damage, death and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028]1. Vector design and construction: Design primers Egfp F: 5'-3'cattctggcgggatccatggtgagcaagggcgagg, Egfp R: 5'-3'CTTGTCGTCGTCGTCCTTGTACAGCTCGTCCATGCC, millitin F: 5'-3'ggacgacgacgacaagggaattggagcagttctgaa, millitin R: 5'-3'GTTTCACTAGCTTG Pci Egfp vector and PCImillitin synthesized in the company were used as templates to amplify egfp and millitin, and then use Egfp F: 5'-3'cattctggcgggatccatggtgagcaagggcgagg and millitin R: 5'-3'GAGAAAGCTTGGATCCTTAACCCCTGTTGCCTCTTAC primers to perform overlap pcr to amplify egfp and millitin Together, after recovery, it was ligated with the Pcambia 3301 vector linearized with the restriction endonuclease BamHI, transformed into DH5a, colony PCR verified that the clones with the correct size were sent for sequencing, and the sequenced correct single colonies were used to extract plasmids and preserve them.
[0029] Pci Egfp vector: Design Egfp primers as follows:
[0030] Egfp F'cagcctcgagaattcatggtgagcaagggcgagga;
[0031] Egfp R': TAC...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap