Method for producing melittin

A technology of melittin and carrier, applied in the field of biological reagent invention, can solve the problems of high melittin activity, cell membrane damage, death and the like

Inactive Publication Date: 2018-07-06
JILIN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, the prokaryotic expression of melittin has the following defects: (1) The eukaryotic protein expressed in the prokaryotic system lacks many post-translational modifications, so that the activity of melittin is not as much as that expressed in the eukaryotic expression system
[0004] At present, the bottleneck of melittin expression in plants is that melittin will damage the cell membrane, and direct expression will cause damage to the cell membrane of engineered bacteria and transgenic plants, resulting in death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing melittin
  • Method for producing melittin
  • Method for producing melittin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028]1. Vector design and construction: Design primers Egfp F: 5'-3'cattctggcgggatccatggtgagcaagggcgagg, Egfp R: 5'-3'CTTGTCGTCGTCGTCCTTGTACAGCTCGTCCATGCC, millitin F: 5'-3'ggacgacgacgacaagggaattggagcagttctgaa, millitin R: 5'-3'GTTTCACTAGCTTG Pci Egfp vector and PCImillitin synthesized in the company were used as templates to amplify egfp and millitin, and then use Egfp F: 5'-3'cattctggcgggatccatggtgagcaagggcgagg and millitin R: 5'-3'GAGAAAGCTTGGATCCTTAACCCCTGTTGCCTCTTAC primers to perform overlap pcr to amplify egfp and millitin Together, after recovery, it was ligated with the Pcambia 3301 vector linearized with the restriction endonuclease BamHI, transformed into DH5a, colony PCR verified that the clones with the correct size were sent for sequencing, and the sequenced correct single colonies were used to extract plasmids and preserve them.

[0029] Pci Egfp vector: Design Egfp primers as follows:

[0030] Egfp F'cagcctcgagaattcatggtgagcaagggcgagga;

[0031] Egfp R': TAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for producing melittin, and in particular relates to a method for producing melittin protein by using an agrobacterium rhizogenes K599-mediated soybean transgenic technology; the method can effectively express the melittin protein. Furthermore, a protease cleavage site is used in the middle of the target protein, so that the melittin is enabled not to kill plant cells; after enterokinase is added into the purified melittin, the melittin can be cleaved. The method enables the melittin protein to be successfully expressed in soybean hairy roots for the first time;compared with the melittin previously expressed in prokaryotes, the melittin produced by the method is higher in activity and solubility; furthermore, the melittin protein expressed in plants can beused for preparing medicines after being subjected to crude extraction since no substance, harmful to a human body, exists in the plants.

Description

technical field [0001] The invention belongs to the field of biological reagent inventions, and in particular relates to a method for producing melittin. Background technique [0002] In the 1970s, foreign countries began to study the molecular biology of melittin, Kindas. Mugge et al injected the mRNA extracted from the queen bee venom gland into frog eggs to synthesize the melittin precursor protein promeliain). Vlasak et al. used the plasmid pBR322 to construct the cDNA library of the queen bee venom, and made a probe with the total mRNA of the queen bee venom to perform hybridization, and obtained the cDNA of melittin, while Wang Guanlin et al. amplified the precursor protein of melittin by RT-PCR The measured sequence length is 155bp, which is exactly the same as the sequence published by Vlasak et al. In addition, by introducing a hydroxylamine cleavage site before the melittin sequence, a mutagenic protein expression vector was constructed by site-directed mutagenesi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/435C12N15/82C12N15/12
CPCC12N15/8205C07K14/43572
Inventor 莫伟亮左泽乘石翔张峻川王彬张力
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap