A kind of method and its application of improving electricity production of Clostridium beijerinckii
A technology of Clostridium beijerinckii and Clostridium beijerinckii, which is applied in the field of environment and new energy, can solve the problems of unclear mechanism of microbial electricity production, weak microbial electricity production capacity, etc., to alleviate the energy crisis, low cost, and high-tech simple effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] This example illustrates the construction method of the Clostridium beijerinckii Cbei_4110 gene insertion inactivation recombinant strain.
[0027] 1. Design intron sequence
[0028] According to the Cbei_4110 gene sequence of Clostridium beijerinckii included in the NCBI database (see SEQ ID NO: 1 in the sequence listing for details), a suitable insertion gene site is designed by means of software ( http: / / www.clostron.com ), select to be inserted between 392 and 393, and generate an intron sequence, synthesize the intron sequence S-392, its sequence is shown in SEQ ID NO: 2, and design primers:
[0029] pWJ-OSC-392-S ggagtgtcgaggatc ctcgag ataattatccttagatgtctctaaag
pWJ-OSC-392-A ggttctcctacagat tgtaca aatgtggtgataacagataag
Cbei-4110-T-S aatcaattgctcctacactctgt Cbei-4110-T-A atgtcaaaatatatggtgattgat
[0030] The sequences thereof are respectively shown in SEQ ID NO: 3-6.
[0031] The two ends of primers pWJ-OSC-392-S a...
Embodiment 2
[0045] This example illustrates the electricity production experiment using 1 g / L glucose by the high-electricity Clostridium beijerinckii constructed above as an anode catalyst.
[0046] (1) Construction of microbial fuel cells
[0047] In this example, a microbial fuel cell using Clostridium beijerinckii to generate electricity as an anode catalyst was established according to existing technologies and methods, including four parts: an anode chamber, a cathode chamber, a proton exchange membrane, and an external circuit. The anode electrode and cathode electrode are PAN-based graphite soft felt (5×5cm), with titanium wire as the external circuit, the external resistance is 1000Ω, the proton exchange membrane is DuPont NafionN117, and the data collector is Keithley series.
[0048] (2) Culture medium formula:
[0049] YPS seed medium: yeast powder 3g / L, peptone 5g / L, glucose 1g / L, ammonium acetate 2g / L, sodium chloride 3g / L, magnesium sulfate heptahydrate 3g / L, potassium dih...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com