Transfer RNA fragments and application thereof
A fragment, the technology of SEQIDNO14-SEQIDNO16, applied in the transfer RNA fragment and its application field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] tRNA-Gly fragment mimics inhibit pancreatic cancer growth
[0024] The pancreatic cancer cell suspension was subcutaneously injected into the groin of nude mice, and randomly divided into 2 groups, with 5 mice in each group. Simultaneously, the tRNA-Gly fragment mimic sequence was injected through the tail vein, injected every other day until the 30th day, and all nude mice were sacrificed. Rats, tumors were removed, examined and measured. The results showed that the injection of tRNA-Gly fragment analogs significantly inhibited the tumor size of pancreatic cancer, see Figure 4 , Figure 4 The three tumor bodies in the middle and upper part are the situation of the control injection group, and the three tumor bodies in the lower part are the situation of the tRNA-Gly fragment mimic injection group. The sequence of the tRNA-Gly fragment mimic is GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT (SEQ ID NO12).
Embodiment 2
[0026] Targeted injection of tRNA-Gly fragment antisense sequence promotes angiogenesis in ischemic lower extremity
[0027] Construct 10 mice lower limb ischemia models and randomly divide them into two groups, A and B. Group A was injected with control nonsense sequence RNA, and group B was injected with tRNA-Gly fragment antisense sequence. Doppler was used to observe the restoration of blood flow. The results showed that compared with the control group, the blood supply of the injection tRNA-Gly fragment antisense sequence group was significantly restored, see Figure 5 , Image 6 , Figure 5 is the case of the control injection group, Image 6 This is the case of the tRNA-Gly fragment antisense sequence injection group. It indicated that injection of antisense sequence of tRNA-Gly fragment could promote angiogenesis in ischemic lower extremity. The antisense sequence of the tRNA-Gly fragment is AGGCGAGAATTCTACCACTGAACCACCAATGC (SEQ ID NO15).
[0028]
[0029] ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap