Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method

A ring-mediated constant temperature and Zymomonas technology, which is applied in the direction of microbial-based methods, biochemical equipment and methods, and microbial measurement/inspection, to achieve strong specificity, low equipment requirements, and short detection time.

Inactive Publication Date: 2017-05-10
HENAN NORMAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no relevant record of the loop-mediated constant temperature gene amplification rapid detection kit and detection method specifically for Zymomonas mobilis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Establishment of rapid detection kit and detection method for ring-mediated constant temperature gene amplification of Zymomonas mobilis

[0026] Step (1), design of primers, assembly of synthetic kits

[0027] The primer sequences determined in this embodiment for detection are as follows:

[0028] Outer primer 1: GTGCAAGATGCGTTGGAAAC,

[0029] Outer primer 2: GGCGTTGATATCGTGATGGA,

[0030] Inner primer 1: GCGATGTTGATCGCACCGTTGT-CTTGTCATCTGCGGTCAGG,

[0031] Inner primer 2: AGCCGGAGCAGAAATCAGAACC-CGGGTATCTTCACCAACACC;

[0032] On this basis, a rapid detection kit for Zymomonas mobilis ring-mediated constant temperature gene amplification is designed, which includes the following reagents:

[0033] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5 mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;

[0034] (2) Reaction solution 2:...

Embodiment 2

[0047] negative control

[0048] Step (1), design of primers, assembly of synthetic kits

[0049] The sequence of primers used for detection determined in this embodiment is the same as that in Example 1.

[0050] On this basis, a rapid detection kit for Zymomonas mobilis ring-mediated constant temperature gene amplification is designed, which includes the following reagents:

[0051] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;

[0052] (2) Reaction solution 2: composed of 10 μmol / L outer primer 1 (F3), 10 μmol / L outer primer 2 (B3), 40 μmol / L inner primer 1 (FIP) and 40 μmol / L inner primer 2 (BIP);

[0053] (3) 8U / μL Bst DNA polymerase;

[0054] (4) Chromogen: SYBR Green I fluorescent dye with a mass concentration of 10%;

[0055] The reaction solution 1 in the above-mentioned loop-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a zymomonas mobilis loop-mediated isothermal amplification of DNA (LAMP) rapid detection kit, and a detection method. According to the zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, large scale genome analysis is carried out based on Bioinformatic Platform, four specific primers are designed based on glyceraldehyde-3-phosphate dehydrogenase gene gap of zymomonas mobilis, combination with LAMP technology is adopted, the rapid, sensitive, accurate detection method on zymomonas mobilis is established, and the rapid detection kit based on the detection method is established. Application of the zymomonas mobilis loop-mediated isothermal amplification of DNA (LAMP) rapid detection kit and the detection is capable of realizing visual inspection identification after reaction, no other analysis steps such as electrophoresis are needed, detection time is short, specificity is high, equipment requirement is low, operation is simple and convenient, and the zymomonas mobilis loop-mediated isothermal amplification of DNA (LAMP) rapid detection kit and the detection method can be used for rapid detection of zymomonas mobilis.

Description

technical field [0001] The invention relates to a kit for rapid detection of bacteria samples using loop-mediated isotherm amplification of DNA (LAMP) technology, in particular to a rapid loop-mediated isotherm amplification of DNA of Zymomonas mobilis Detection kits and detection methods. Background technique [0002] In recent years, with the rapid and continuous growth of population and industry, energy consumption has been greatly accelerated, leading to a potential energy crisis in the world. At the same time, the continuous increase in fuel prices and the sharp reduction of fossil fuels have prompted a global search for alternative renewable energy sources. Among them, biofuels are considered to be the most important substitutes for traditional fossil fuels. Bioethanol is a kind of renewable energy. Its consumption process not only solves the problem of environmental pollution caused by traditional fuels, but also solves the huge pollution caused by the leftovers of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2563/107
Inventor 徐雅梦姜晓冰姜晓杰于涛张艺鸽
Owner HENAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com