Special primers for auxiliary identification of peony variety Fengdan seed fatty acid synthesis
A peony and variety technology, applied in the field of molecular biology, can solve problems such as weak basic research, and achieve the effects of saving the cost of measurement and making the detection convenient and quick.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Preparation of standard solution
[0025] Preparation of internal standard solution: Dissolve 30 mg of methyl nonadecanoate (Methyl nonadecanoate) standard product in 10 mL of methanol to prepare a standard solution with a mass concentration of 3 mg / mL for use.
[0026] Determination of fatty acid composition
[0027] (1) Each weighed 300 mg of seeds of peony cultivar 'Fengdan' at different days (50-130 days) after pollination, fully ground them into powder with liquid nitrogen, dissolved them in chloroform, and stored them at -20°C.
[0028] (2) Take 1 mL of the total lipid dissolved in chloroform into a 10 mL penicillin vial.
[0029] (3) Add 100 μL of internal standard solution, and then add 2.5 mL of 2% H 2 SO 4 : methanol solution (v:v).
[0030] (4) 85°C water bath for 2.5 hours.
[0031] (5) After the reaction is completed, cool to room temperature, add 1 mL of n-hexane (chromatographic grade) and 1 mL of saturated NaCl solution, shake, and place to separate...
Embodiment 2
[0042] Homologous amplification of embodiment 2 PsOLE1 gene
[0043] Seeds from 7-8-year-old peony cultivar 'Fengdan' healthy plants (planted in the experimental field of Qingdao Agricultural University in Shandong Province) were quick-frozen in liquid nitrogen and stored in a -80°C refrigerator for use in homologous amplification of the PsOLE1 gene and RACE PCR reaction.
[0044] (1) Homologous amplification:
[0045] The reaction system was 50 μL, and the components were as follows: 2 μL reverse-transcribed cDNA, 5 μL 10×LA TaqBuffer II (Mg 2+ Plus), 4 μL dNTP Mixture (2.5 mM each), Primer F / R (F: GTCACWGCYGGTGGRTCTCT, R: CCAAACTGCTCCAGCYCTGTC) (10 μM) each 2 μL, 0.4 μL LA Taq (5 U / μL) and 34.6 μL ddH 2 O.
[0046] Gradient PCR amplification conditions for homologous clones: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30s, annealing at 50-60°C for 30s, extension at 72°C for 30s, a total of 35 cycles, and finally extension at 72°C for 10 minutes, and s...
Embodiment 3
[0047] Example 3: RACE PCR of the PsOLE1 gene:
[0048] according to According to the requirements of RACE primers (23-28nt, 50-70% GC, Tm≥65°C) in the RACE 5' / 3' Kit manual, design gene-specific primers (gene -specific primers, GSPs, GSP5': CACCGAATCCACCTGAAGCAAGAAAC, GSP3': TGCTTCAGGTGGATTCGGTGTGGC). 50μL system, 5'-RACE composition is as follows: 2.5μL 5'-RACE-Ready-cDNA, 5μL 10×UPM, 1μL GSP5'(10μM), 41.5μL Master Mix; 3'-RACE composition is as follows: 2.5μL 3'-RACE - Ready-cDNA, 5 μL 10×UPM, 1 μL GSP3′ (10 μM), 41.5 μL Master Mix. The RACE amplification reaction conditions are as follows: 94°C, 30s, 68°C, 30s, 72°C, 3min, a total of 25 cycles. The total RNA from seeds at different stages was mixed as a template for the synthesis of the first-strand cDNA (5'-RACE-Ready-cDNA and 3'-RACE-Ready-cDNA). Using 5'-RACE-Ready-cDNA and 3'-RACE-Ready-cDNA as templates, gene-specific primers (GSP5' and GSP3') were paired with UPM, and amplified by RACE PCR to obtain 5'-RACE PCR ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap