Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation
A composition and engineering technology, applied in the direction of drug combination, genetic engineering, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0509] Example 1: Method improvements for simplified cloning and delivery.
[0510] Instead of encoding the U6-promoter and guide RNA on a plasmid, Applicants amplified the U6-promoter with DNA oligonucleotides for addition to the guide RNA. The resulting PCR product can be transfected into cells to drive expression of the guide RNA.
[0511] Exemplary primer pairs that allow generation of a PCR product consisting of a U6-promoter::guide RNA targeting the human EMX1 locus:
[0512] Forward primer: AAACTCTAGAGagggcctatttcccatgattc
[0513] Reverse primer (carries guide RNA, which is underlined):
[0514] acctctag AAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATG CTGTTTTGTTTCCAAAACAGCATAGCTCTAAAACCCTAGTCATTGGA GGTGACGGTGTTTCGTCCTTTCCACaag
example 2
[0515] Example 2: Method improvements for improving activity:
[0516] Instead of expressing guide RNA in eukaryotic cells using the pol3 promoter (specifically RNA polymerase III (e.g. U6 or H1 promoters), Applicants expressed T7 polymerase in eukaryotic cells to drive the expression of guide RNA using the T7 promoter Express.
[0517] An example of this system can involve the introduction of three pieces of DNA:
[0518] 1. Cas9 expression vector
[0519] 2. Expression vector of T7 polymerase
[0520] 3. Expression vector comprising guide RNA fused to the T7 promoter
example 3
[0521] Example 3: Method improvement for reducing the toxicity of Cas9: Cas9 was delivered in the form of mRNA.
[0522] Delivery of Cas9 as mRNA allows for transient expression of Cas9 in cells to reduce toxicity. For example, the following primer pairs can be used to amplify humanized SpCas9:
[0523] Forward primer (to be added to the T7 promoter for in vitro transcription): TAATACGACTCACTATAGGAAGTGCGCCACCATGGCCCCAAAGAAGAAGCGG
[0524] Reverse primer (to add to polyA tail): GGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTttcttaCTTTTCTTTTTTGCCTGGCCG
[0525] Applicants transfected Cas9 mRNA into cells with guide RNA in the form of an RNA or DNA cassette to drive expression of the guide RNA in eukaryotic cells.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com