Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method
An identification method, a technology of upland cotton, applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of affecting the quality of machine-picked cotton, poor management, and shedding of cotton bolls in the middle and lower parts, and achieve The identification results are stable and reliable, the effect of improving selection efficiency and speeding up the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment one. A kind of identification method of upland cotton sub-chicken foot leaf germplasm material, the steps are as follows:
[0027] 1. Take fresh young leaves of upland cotton material at the seed or seedling stage, extract genomic DNA, test the DNA quality, and dilute to 50ng / ul;
[0028] 2. According to the known cotton EST series, SSRhunter software designed a pair of specific SSR marker primers, forward primer: 5'-GATGCACCAGATCCTTTTAT-3' (SEQ ID No.1); reverse primer: 5'-GGTACATCGGAATCACAGT-3' ( SEQ ID No. 2).
[0029] The EST sequence of the designed primer is as follows (SEQ ID No.3), and the underline indicates the position of the primer.
[0030] CTGGACTAACACCAATAATCACTAAACTTTGATTAAAATAACATTTCAGTTACTAAACTTTCAAAAGTGACAAATCAGTCATTAACATTTACGAAAAGTGACAAATTAGTCACCTGAGAGTGGACATCTGACGTGGCCCGTTAGGGTGCCACGTTGAACATGATCG GATGC ACCAGATCCTTTTAT TAGTTTTATAAGGATTACCAACTAAATAGAAGAAGAAGAAGAAGAGGAAGAAGAAGAAGAAAAGGAAGAAGAAGAAGAAGAATAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA...
Embodiment 2
[0036] Embodiment two. Carry out the identification of sub-chicken foot leaf to 100 samples with the inventive method
[0037] 1. Materials:
[0038] Using the normal broad-leaved material Lumianyan No. 28 as the female parent and the homozygous material S131189 of the sub-chicken's foot leaf as the male parent, a sub-chicken's foot leaf and normal broad-leaved F 2 group.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap