Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe and kit for evaluating skin anti-aging condition

An anti-aging, kit-based technology, applied in the field of beauty, can solve problems such as difficult to achieve personalized maintenance or treatment, and achieve the effect of clear molecular mechanism, strong specificity and high sensitivity

Inactive Publication Date: 2016-08-17
FUJIAN AIWO HEALTH BIOTECH CO LTD
View PDF4 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The above patents / patent applications all use foreign substances to regulate the expression of genes in the body, but there are different SNP sites in the genes of each individual. This method is difficult to achieve personalized maintenance or treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and kit for evaluating skin anti-aging condition
  • Primer, probe and kit for evaluating skin anti-aging condition
  • Primer, probe and kit for evaluating skin anti-aging condition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1: Primer and probe design

[0079] 1. Design and synthesize the following primers and probes. Synthesis unit: Applied Biosystems, USA Applied Biotechnology Co., Ltd.

[0080] SOD2(rs4880) primer and fluorescent probe sequence:

[0081]

[0082] SOD2 (rs5746136) primer and fluorescent probe sequence:

[0083]

[0084] NQO1 (rs1800566) primer and fluorescent probe sequence:

[0085]

[0086] GPX3 (rs3828599) primer and fluorescent probe sequence:

[0087]

[0088] GPX1 (rs1050450) primer and fluorescent probe sequence:

[0089]

[0090] GSTM1 (GSTM1-null) primer sequence:

[0091] Forward primer GAACTCCCTGAAAAGCTAAAGC SEQ ID NO:21

[0092]Reverse primer GTTGGGCTCAAATATACGGTGG SEQ ID NO: 22

[0093] GSTT1 (GSTT1-null) primer sequence:

[0094] Forward primer TTCCTTACTGGTCCTCACATCTC SEQ ID NO:23

[0095] Reverse primer TCACCGGATCATGGCCAGCA SEQ ID NO: 24

[0096] 2. SNP site detection

[0097] 1), sample collection. Human saliva was used as...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and a kit for evaluating the skin anti-aging condition. The sequences of the primer and the probe are shown as SEQ ID NO:1-4, SEQ ID NO:5-8, SEQ ID NO:9-12, SEQ ID NO:13-16, SEQ ID NO:17-20, SEQ ID NO:21-22 and SEQ ID NO:23-24, wherein the ends 5' and the ends 3' of SEQ ID NO:3-4, 7-8, 11-12, 15-16 and 19-20 are connected with different fluorescent marks respectively. The invention further discloses a method for assisting a client in selecting a correct beautifying method through gene detection. Internal causes and external causes generated by skin aging of the client are known, an individual beauty and health solution is provided for the client, and the effect of an anti-aging beautifying product is maximal.

Description

technical field [0001] The invention relates to the field of cosmetology, in particular to a primer, a probe and a kit for evaluating skin anti-aging conditions. Background technique [0002] SNP (single nucleotide polymorphism) refers to the variation of a single nucleotide on the genome, including transitions, transversions, deletions, and insertions. It is the most common genetic marker, and its carrying frequency in the population is greater than 1%. , and are widely used in the fields of human disease diagnosis, individualized drug use, and basic biological research. With the in-depth study of different SNP sites, through the combined detection of multiple SNP sites and subsequent data analysis, personalized health solutions can be formulated for the genetic information of different groups of people. [0003] The appearance of human skin is affected by internal and external factors. External factors include ultraviolet rays, environmental pollution, improper use of bea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 纪志梁王毛阳杨志云刘晓瑜
Owner FUJIAN AIWO HEALTH BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com