Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of aldehyde dehydrogenases 1A3 and encoding gene thereof as target for preventing and treating invasion and metastasis of colorectal cancer

A technology of acetaldehyde dehydrogenase and colorectal cancer, applied in the field of biomedicine, can solve problems such as unclear molecular regulation mechanism

Inactive Publication Date: 2016-07-06
THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the relationship between ALDH activity and the invasion and metastasis of colorectal cancer cells, the specific subtypes that determine ALDH activity, the relationship between its expression and the invasion and metastasis of colorectal cancer cells and the prognosis of patients, and the related molecular regulatory mechanisms are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of aldehyde dehydrogenases 1A3 and encoding gene thereof as target for preventing and treating invasion and metastasis of colorectal cancer
  • Application of aldehyde dehydrogenases 1A3 and encoding gene thereof as target for preventing and treating invasion and metastasis of colorectal cancer
  • Application of aldehyde dehydrogenases 1A3 and encoding gene thereof as target for preventing and treating invasion and metastasis of colorectal cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not indicated in the preferred embodiments are usually carried out according to conventional conditions, or according to the conditions suggested by the manufacturer.

[0033] In a preferred embodiment, the coding DNA sequence of the shRNA that inhibits ALDH1A3 gene expression is any one of the following three sequences (the underlined part is the loop sequence):

[0034] 1: gctgtattagaaccctcagatctc cgggatccaa gagatctgagggttctaatacagcttttttg (SEQ ID No. 1);

[0035] 2: gccgaatacacagaagtgaaactc cggatccaa gagtttcacttctgtgtattcggcttttttg (SEQ ID No. 2);

[0036] 3: aaccaatactgaagttcaactc cgggatccaa gagttgaacttcagtattggttgcttttttg (SEQ ID No. 3).

[0037] The construction method of ALDH1A3 gene shRNA expression vector comprises the following steps:

[0038] 1) Synthesize the foll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses applications of aldehyde dehydrogenases (ALDH) 1A3 and an encoding gene thereof as a target for preventing and treating invasion and metastasis of colorectal cancer and as an independent prognostic determination factor for the colorectal cancer, and also an application of an expression down-regulation agent, an activity inhibitor and an over-expression effect inhibitor of the ALDH 1A3 in preparation of medicines for reversing the invasion and metastasis of colorectal cancer. The applications have important significance of preventing and treating the invasion and metastasis of colorectal cancer and prognostic determination of the colorectal cancer.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to the application of acetaldehyde dehydrogenase 1A3 and its coding gene as a target for preventing or treating tumor invasion and metastasis. Background technique [0002] Colorectal cancer is a serious threat to human health, and invasion and metastasis are the most important cause of death in colorectal cancer patients. Therefore, it is of great clinical significance to explore the targets and molecules targeting the invasion and metastasis of colorectal cancer, and then develop related therapeutic drugs. [0003] The human acetaldehyde dehydrogenase (Aldehydehydrogenases, ALDH) family contains 19 subtypes, and different ALDH subtypes have different subcellular locations (including nucleus, mitochondria and cytoplasm) and different functions. Previously, it was believed that this family could participate in the regulation of many important pathophysiological processes, includi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N33/574G01N33/573A61K45/00A61K31/136A61K31/145A61K31/708A61K31/7068A61K31/194A61P35/00
CPCA61K31/136A61K31/145A61K31/194A61K31/7068A61K31/708A61K45/00C12Q1/6886C12Q2600/118G01N33/573G01N33/57446G01N2333/90203
Inventor 余时沧卞修武段江洁许森林胡启萍王君
Owner THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com