Platanus pollen allergen Pla a 3 and monoclonal antibody thereof
A monoclonal antibody, sycamore technology, applied in chemical instruments and methods, anti-plant immunoglobulins, biochemical equipment and methods, etc., can solve problems such as little known allergens
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] The present invention will be further described below in combination with specific embodiments and accompanying drawings.
[0025] Identification of sycamore pollen allergen Plaa3:
[0026] pSUMO-Mut-Plaa3 plasmid construction:
[0027] The complete sequence of the target gene Plaa3 (SEQIDN0.2) was artificially synthesized and connected between the StuI and XhoI sites of the vector pSUMO-Mut, and the obtained recombinant plasmid pSUMO-Mut-Plaa3 was transferred into the ArcticExpress expression strain. The positive clones were picked for sequencing, and the sequencing results are shown below, the single-lined region is the Plaa3 gene region.
[0028] TATTTGAGGCTCACCGCGAACAGATTGGAGGT GCCATAACATGTGGTACGGTGGTGACCAGGCTGACCCCATGCCTCACCTTCTTGCGCTCTGGTGGGGCTGTAGCGCCCGCTTGCTGCAACGGCGTGAAGGCACTCAACAACGACGCTAAAACCACCCCAGACCGTCAGGCCGCTTGTGGATGTTTGAAGACTGCCTCCACCTCCATCTCCGGGATCCAGCTCGGTAACGCTGCCTCGCTTGCCGGCAAATGTGGTGTTAATCTCCCTTACAAGATCAGCCCCACCATTGACTGCTCCAAGGTGAAGTGA CTCGAGCACC...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Theoretical molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com