Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-CTLA-4 and PD-1 dual variable domain immunoglobulin

A technology of CTLA-4 and PD-1, which is applied in the direction of hybrid immunoglobulins, antibodies, anti-tumor drugs, etc., and can solve problems such as statistical differences

Inactive Publication Date: 2015-10-21
BEIJING BIYANG BIOTECH
View PDF7 Cites 42 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the docetaxel group, the improvement in OS was more significant and statistically significant in the nivolumab group

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CTLA-4 and PD-1 dual variable domain immunoglobulin
  • Anti-CTLA-4 and PD-1 dual variable domain immunoglobulin
  • Anti-CTLA-4 and PD-1 dual variable domain immunoglobulin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1, anti-CTLA-4 antibody and anti-PD-1 antibody sequence

[0038] Anti-CTLA-4:

[0039]

[0040]

[0041] Anti-PD-1 antibody sequence:

[0042]

[0043]

[0044]

Embodiment 2

[0045] Example 2, Synthesis of Ipi(out)-L-Niv(in)DVD-Ig Bispecific Antibody BY18.1 Gene and Construction of Expression Vector

[0046] 1) Based on the sequence of the CTLA-4 antibody Ipilimumab and the sequence of the anti-PD-1 antibody Nivolumab. Sequence commissioned Shanghai Jierui Bioengineering Co., Ltd. to synthesize the Ipi-L(out)-Niv-L(in)DVD-Ig bispecific antibody light chain (L chain) coding gene, and optimized the coding gene to be suitable for Coding gene expressed by CHO cells. Ligated to the p327.7 expression vector (patent application number: 201410441296.0) by XhoI-EcoRI double digestion. Named BY18.1L.

[0047] CTCGAGCCACC GAGACCGACACACTCCTCCTGTGGGTGCTGCTGCTGTGGGTGCCTGGCTCCACTGGCGAGATCGTGCTGACACAGTCCCCTGGCACCCTGTCTCTGTCCCCAGGCGAGCGCGCCACCCTGTCTTGCCGCGCCTCTCAGAGCGTGGGCTCCTCTTACCTCGCTTGGTATCAGCAGAAGCCCGGCCAGGCTCCAAGACTCCTCATCTACGGCGCTTTCAGTCGGGCTACAGGCATTCCCGACCGGTTCAGCGGCAGCGGCTCCGGCACAGACTTCACCCTCACTATTTCGCGCCTCGAACCCGAGGACTTCGCCGTGTACTACTGCCAGCAGTACGGCTCTA...

Embodiment 3

[0057] Example 3, Synthesis of Niv(out)-L-Ipi(in)DVD-Ig bispecific antibody BY18.2 gene and construction of expression vector

[0058] 1) Similarly, based on the sequence of the CTLA-4 antibody Ipilimumab and the sequence of the anti-PD-1 antibody Nivolumab. Entrusted Shanghai Jierui Bioengineering Co., Ltd. to synthesize the Niv-L(out)-L-Ipi-L(in)DVD-Ig bispecific antibody light chain (L chain) coding gene, and optimize the coding gene to a suitable Coding gene expressed in CHO cells. Ligated to the p327.7 expression vector (patent application number: 201410441296.0) by XhoI-EcoRI double digestion. Named BY18.2L.

[0059] CTCGAGCCACC GAGACCGACACACTCCTCCTGTGGGTGCTGCTGCTGTGGGTGCCTGGCTCCACTGGCGAGATTGTGCTGACACAGTCCCCCGCTACTCTGAGCCTGAGCCCTGGCGAGAGGGCTACACTGTCTTGCAGAGCTTCTCAGTCCGTGTCTTCTTACCTCGCTTGGTATCAGCAGAAGCCCGGCCAGGCTCCAAGACTGCTGATCTATGACGCTTCTAACCGCGCTACAGGCATTCCTGCTAGGTTCAGCGGCAGCGGCTCTGGCACCGACTTCACACTCACAATTAGCTCTCTTGAACCTGAGGACTTCGCCGTGTACTACTGCCAGCAGTCTAGCAACTGGCCTAG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Theoretical molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a specific-binding PD-1 and / or CTLA-4 dual variable domain immunoglobulin (DVD-Ig) obtained by modifying anti-PD-1 and CTLA-4 antibodies through adopting a molecular biology method. An anti-PD-1 antibody variable domain is intramolecular and an anti-CTLA-4 antibody is extramolecular, the anti-PD-1 antibody variable domain is extramolecular and the anti-CTLA-4 antibody is intramolecular, and two structures respectively keep the combination characteristics of PD-1 and / or CTLA-4 molecules. The anti-CTLA-4 and PD-1 dual variable domain immunoglobulin has potential tumor treatment values.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to the construction, screening and preparation methods of anti-CTLA-4 and PD-1 antibody dual variable domain immunoglobulin (DVD-Ig) and its potential anti-tumor application in therapy. Background technique [0002] Immune checkpoints are some inhibitory signaling pathways in the immune system, which avoid tissue damage by regulating the persistence and intensity of immune responses in peripheral tissues, and are involved in maintaining tolerance to self-antigens (Pardoll DM. The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer, 2012, 12(4): 252-264.). Studies have found that tumor cells use the inhibitory signaling pathway of immune checkpoints to inhibit the activity of T lymphocytes, thereby evading the immune system in vivo, especially the killing effect of T lymphocytes on tumors (Yao S, Zhu Y, Chen L. Advances in targeting cell surface signaling mol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/46A61K39/395A61P35/00
CPCA61K39/395C07K16/46
Inventor 胡品良何芸白洁洪伟东邹敬宋凌云杨泽荣
Owner BEIJING BIYANG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com