Verticillium dahliae Kleb. pathogenic associated protein VdSENP1 and encoding gene thereof

A technology of Verticillium dahliae and coding gene, which can be applied in the biological field and can solve the problems of strong variation of race differentiation, difficult research, difficulty in genetic breeding of disease resistance, etc.

Active Publication Date: 2015-03-25
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The fundamental reason is that the genetic background of crops such as cotton is complex, and it is difficult to conduct in-depth research at the molecular level. In addition, the reasons for the strong variability in race differentiation of Verticillium dahliae (Veriicillium dahliae) are also reasons for the genetic breeding of disease resistance. to many difficulties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Verticillium dahliae Kleb. pathogenic associated protein VdSENP1 and encoding gene thereof
  • Verticillium dahliae Kleb. pathogenic associated protein VdSENP1 and encoding gene thereof
  • Verticillium dahliae Kleb. pathogenic associated protein VdSENP1 and encoding gene thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1. Preparation of the pathogenic gene VdSENP1 of Verticillium dahliae Kleb.

[0046] The wild-type strain 592 of Verticillium dahliae was extracted (strain 592 was collected from a cotton field in Xinjiang, and the literature recording this material is a rapid detection of the pathogenic type of Verticillium dahliae in cotton plants. Xinjiang Agricultural Science 2010, 47(4): 827- 831, which the public can obtain from the Institute of Microbiology, Chinese Academy of Sciences) was reverse-transcribed into cDNA, and using the cDNA as a template, RT-PCR amplification was carried out with the following primers 1 and 2:

[0047] Primer 1: g CCCGGG ATGGGGTCAAAAAAACATGTCC (upstream primer, the underlined part is Sma I);

[0048] Primer 2: c ACTAGT TCATGCATAAGGATATTCGC (downstream primer, underlined part is Spe I).

[0049] The PCR amplified product is proved by cloning and sequencing, the amplified product has the nucleic acid sequence shown in the 383-3577th n...

Embodiment 2

[0050] Example 2. Functional verification of the pathogenic gene VdSENP1 of Verticillium dahliae Kleb.

[0051] (1) Construction of expression vector

[0052] The construction method of the fungal expression vector 1300HPH-VdSENP1 is as follows: first, the vector pCAMBIA-1300221 (the document recording the pCAMBIA-1300221 plasmid is Satellite RNA-derived satsiR-12 targeting the 3'UTR of Cucumber mosaic virus triggers viral RNAs for degradation. Journal of Virology.201185.13384-13397, the public can obtain the plasmid from the Institute of Microbiology, Chinese Academy of Sciences.) Digest the vector fragment and pKOV21 vector with Sma I (the document describing the pKOV21 vector is Different chitin synthase genes are required for various developmental and plant infection processes in the rice blast fungus Magnaporthe oryzae, PLoS Pathogen, 20128: e1002526, and the public can obtain the plasmid from the Institute of Microbiology, Chinese Academy of Sciences.) The HPH fragment o...

Embodiment 3

[0139] Example 3. Research on other functions of the pathogenic gene VdSENP1 of Verticillium dahliae Kleb.

[0140] (1) VdSENP1 gene plays a role in promoting the growth and development of Verticillium dahliae hyphae

[0141] Bacterial blocks were excavated from the Verticillium dahliae wild-type strain 592 grown on the PDA plate and placed in Chapeauer's medium for cultivation at 28° C. and 200 rpm. On the fourth day, the materials were collected, the spores were filtered out with four layers of gauze, and the RNA of the mycelia and spores were extracted respectively, and the northern hybridization was carried out. The nucleotide sequence of the probe has the sequence shown in the 2154th-2580th nucleotides of SEQ ID No. 1 in the sequence listing. See the results of Northern hybridization Figure 7 , Figure 7 The results showed that the expression level of VdSENP1 gene in mycelia was higher than that in spores, and the colonies of mutant vdsenp1 grew slowly. figure 2 See...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses verticillium dahliae Kleb. pathogenic associated protein VdSENP1, an encoding gene thereof, and application. The protein VdSENP1 is protein possessing one of the following amino acid residue sequences: 1) an amino acid residue sequence shown as a sequence table SEQ ID No. 2; and 2) protein which is associated with fungus pathopoiesis and is derived from 1) by substituting and / or deleting and / or adding one or more of amino acid residues on the basis of the amino acid residue shown in the sequence table SEQ ID No. 2. The protein and the encoding gene thereof have extremely important meaning on culturing verticillium-wilt-resistant cotton and improving cotton output and quality.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a pathogenicity-related protein of Verticillium dahliae Kleb. and a coding gene thereof. Background technique [0002] Verticillium dahliae Kleb., caused by the soil filamentous fungus Verticillium dahliae Kleb., is a major disease that threatens cotton production. It has seriously affected the quality and yield of cotton in my country for many years. Cotton verticillium wilt was first seen in Virginia in the United States in 1914, and was subsequently discovered in other states and cotton-growing countries around the world (Shen Qiyi, 1992). It was introduced into my country with the introduction of American cotton varieties in 1935, but the damage was not serious. After the 1950s, verticillium wilt occurred successively in some cotton areas in the north and south of my country, and the speed of spread accelerated. In the late 1980s, verticillium wilt had spread to 478 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/37C12N15/31C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11C12N1/14C12R1/645
CPCC12N9/58C12N1/145C12R2001/645
Inventor 郭惠珊赵云龙
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products