A nematode apoptosis regulation gene ced-4 inducible promoter, rice expression vector and preparation method thereof
A technology for expression vector and gene regulation, applied in the direction of using vector to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem that expression vector has not been reported yet.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The wn-2 promoter sequence is as SEQ ID NO. 1;
[0035] The promoter wn-2 and P35S (SEQ ID NO.7) were cloned into the pCAMBIA1305.1 vector (wn-2 is located in front of P35S) to obtain the intermediate vector pCA-Wn-2. The primers for amplifying the Wn-2-P35S fusion product are as follows:
[0036] Wn-2-P35S-FP:
[0037] AAAGAATTC-TTCTAGCCACCAGATTTGACCAAACCATCAACTCATCTGTATATAATATGGAGTCAAAGATTCAAATAGAGGACC (SEQ IDNO.3);
[0038] Wn-2-P35S-RP:
[0039] AAAACTAGTCTGCAGAGTCCCCCGTGTTCTCTCCA (SEQIDNO.4);
[0040] The specific process is: insert EcoRI and SpeI (before the p35S promoter and the front part of GUS) into the pCAMBIA1305.1 vector through EcoRI and SpeI sites to obtain the intermediate vector pCA-Wn-2;
[0041] The target gene ced-4 was cloned into the pCA-Wn-2 vector (via the PstI and PmlI sites) to obtain the rice expression vector, which was named pCA-wn-2-CED-4 expression vector, pCA-wn-2 -The sequence of the CED-4 expression vector is shown in SEQ ID NO. 2;
[0042] The pri...
Embodiment 2
[0047] Example 2 Verification of Rice Expression Vector
[0048] The constructed rice expression vector, through various treatments, experimental design and induction, experimental steps and results are as follows:
[0049] (1) Transgenic rice seedlings were inoculated with Hirschsprung's root nematode.
[0050] (2) To detect the apoptosis and allergic reaction phenotypes of rice root epidermal cells, see the statistical table of staining test results.
[0051] (3) For the detection of CED-4 protein expressed by the transgenic target gene, see the attached drawings in the instruction manual.
[0052] Dyeing method for measuring allergic reaction of rice root cells:
[0053] The roots of rice were dyed separately for 15 minutes and rinsed with running water to remove unbound dyes. The dyes bound to dead cells were extracted with a solution containing 50% methanol and 1% SDS at 50°C for 30 minutes, and the light absorption value of the extract was measured. The measurement wavelength of p...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com