A method of cultivating male sterile plants using a virus-induced gene silencing system
A technology for male sterility and planting, which is applied in botany equipment and methods, genetic engineering, plant genetic improvement, etc., can solve the problems of hybrid sterile plants, restrictions, and increased production costs, and achieve less field work and less time. Short, cost-saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Construction of VIGS vector for silencing rapeseed COI1 gene
[0040] 1.1 Obtaining the cDNA of the COI1 gene in rape
[0041] Cultivate rape seedlings, and when they grow to about 10cm, extract the total RNA from the stem and cotyledons with the TRIZOL method, obtain the cDNA corresponding to the rape total RNA through reverse transcription, and take a small amount of cDNA as a template. The forward primer is: AAATCTAGAGTGTCTCCGAACCATAGGC, reverse The primers are: TCTCTCACCTCTCCAAGCTG, and a 514 bp cDNA fragment of the rape COI1 gene (SEQ ID NO. 1 (1181) to (1694)) is obtained by PCR amplification.
[0042] 1.2 Obtaining the pTRV2 vector containing the COI1 gene of rape
[0043] The cDNA fragment of COI1 gene was digested with XbaI, and the plasmid pTRV2 was digested with XbaI and EcoICRI. The digestion systems were: 1.5μL Buffer (Buffer3), 1μL XbaI, 5μL COII gene cDNA fragment, supplemented with water to 15μL; 1.5μL Buffer (BufferMultiCore) , 0.5μL Xba1, 0.5μLEcoICRI0.1μL...
Embodiment 2
[0074] 1. Experimental rape seedling sowing, vernalization and seedling cultivation
[0075] Sowing rape Zhongshuang 11, using plastic fiber as the fixation, MS liquid medium as the nutrient, spraying 1 / 500 diluted chlormequat on the stems to about 5cm to inhibit the excessive growth of rape seedlings. Vernalization begins after half a month , Vernalization conditions are 9h during the day, 9℃; 15h at night, 40℃. After 14 days of vernalization, they were recovered at 12°C for 2 days and 9 hours in the day and 15 hours in the night. After resuscitation, they were moved to a greenhouse at 25°C for cultivation.
[0076] 2. Infect rape seedlings with Agrobacterium containing VIGS vector to cultivate rape lines that silence COI1 gene
[0077] 2.1 Agrobacterium preparation for infection
[0078] GV-C, GV-1 and GV-COI1 were added to 6ml YEB medium, 6μLRif, 6μL Kan, and three single bacteria were inoculated, and cultured overnight at 28℃, 220rpm. shaking; then, in 50ml YEB medium Add 50μLR...
Embodiment 3
[0103] The corresponding sequence of tobacco COI1 gene ((444)..(952) of SEQ ID NO.2) was constructed into VIGS vector, and after infecting tobacco, male sterile plants of tobacco were also obtained. Such as Figure 8 As shown, tobacco with the COI1 gene silenced caused infertility due to abnormal stamen development.
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com