Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Constitutive expression promoter and application thereof

A constitutive expression, promoter technology, applied in the field of plant biology, can solve problems such as insufficient

Active Publication Date: 2014-03-26
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some constitutive promoters have been isolated in previous work, these are far from enough, and we still need to do a lot of work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constitutive expression promoter and application thereof
  • Constitutive expression promoter and application thereof
  • Constitutive expression promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] The methods used in the following examples are conventional methods unless otherwise specified. The primers used are all synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and sequencing is completed by Beijing Huada Gene. PCR kits and endonucleases used in the construction of vectors are purchased From Bao Bioengineering Co., Ltd., pEASY-T1 ligation kit was purchased from Beijing Quanshijin Biotechnology Company, and T4 DNA ligase was purchased from Promega Company. The methods were all carried out according to the method provided in the kit. The carrier pHPG used in the experiment was modified from this experiment (the structural diagram of the carrier pHPG is figure 1 Shown), the basic skeleton comes from the pCAMBIA1303 of CAMBIA.

[0032] 1. Isolation and identification of promoter SOY001P

[0033] Design primers required for cloning promoter SOY001P:

[0034] Primer 1: 5'ggtacc ATAATGCATGTGCCTGACCAG 3'

[0035] Primer 2: 5'actagt AGTTGCAGAGAAGAGAATCGAA 3'

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant biotechnology, and particularly relates to functional identification and application of a soybean constitutive expression promoter SOY001P. The promoter SOY001P disclosed by the invention has very high expression activity in tissues and organs such as roots, stems, leaves and flowers of plants, and has an excellent application prospect in the field of plant transgene.

Description

Technical field [0001] The invention belongs to the field of plant biotechnology, and specifically relates to the functional identification and application of a constitutive expression promoter SOY001P isolated from soybean. Background technique [0002] The foreign DNA sequence is linked to a specific promoter to initiate expression in the plant host. The choice of promoter type determines the time and position of gene expression. According to the different characteristics of promoters driving gene expression, promoters are divided into constitutive promoters and specific promoters; constitutive promoters can initiate transcription in all cells or tissues regardless of time and space; specific promoters are also It can be divided into tissue-specific promoters and inducible promoters. At present, some constitutive strong promoters are widely used in the field of agricultural biotechnology. Highly active constitutive promoters have good application prospects in plant gene functi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/84C12N15/11A01H5/00
Inventor 周君莉李早霞吴洁芳赵静卫静
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com