Sugarcane genome endogenous reference gene acetolactate synthase gene PCR (polymerase chain reaction) primer sequences and amplification method
A technology of acetolactate synthase and internal standard gene, applied in recombinant DNA technology, DNA/RNA fragments, DNA preparation, etc., can solve the problem of no research report on copy number, achieve easy judgment, ensure amplification efficiency, and applicability wide effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] (1) PCR amplification of the internal standard gene acetolactate synthase gene in the sugarcane genome
[0022] Acetolactate synthase gene PCR primer sequence is: ScALS-F : CTCCCAGTGAAGGTCTTTGCG; ScALS-R : TGCTGGAATGTTGAACCCTTTT.
[0023] PCR reaction system: 1.0 U Taq DNA polymerase, 1×PCR buffer solution, 0.25 mM dNTP, 3.0 mM MgCl2, primers ScALS-F with ScALS-R Each 0.25 mM, DNA template 25 ng, the total volume of the reaction system is 25??l;
[0024] PCR amplification conditions: pre-denaturation at 95°C for 6 min; denaturation at 94°C for 30 s; annealing at 65°C for 30 s, extension at 72°C for 35 s, a total of 35 cycles, and a final extension at 72°C for 6 min.
[0025] (2) Electrophoresis detection of PCR product of sugarcane acetolactate synthase gene and analysis of product specificity and generality
PUM
Property | Measurement | Unit |
---|---|---|
PCR efficiency | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap