Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles

A technology of non-enzyme amplification and detection method, which is applied in the field of detection of microRNA based on the principle of non-enzyme amplification combined with electrochemiluminescence, which can solve the problems of cumbersome operation and achieve the effect of simple reaction device, simple operation and low cost

Inactive Publication Date: 2013-11-06
SOUTH CHINA NORMAL UNIVERSITY
View PDF12 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods have high detection sensitivity and short time-consuming, but the required operations are cumbersome, technology-intensive, and require expensive instruments and equipment as the support of these technologies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles
  • MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles
  • MicroRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The microRNA-21 closely related to human cancer was selected as the detected microRNA. The sequence of microRNA-21 is: UAGCUUAUCAGACUGAUGUUGA.

[0034] The steps for detecting microRNA-21 using the microRNA detection method based on the principle of non-enzyme amplification and electrochemiluminescence are as follows:

[0035] 1) Design DNA hairpin probes

[0036] According to the principle of non-enzymatic amplification and microRNA-21 sequence, the hairpin H1 and hairpin H2 sequences required by the non-enzymatic amplification system were designed; the microRNA-21 sequence was UAGCUUAUCAGACUGAUGUUGA, and the hairpin H1 and hairpin H2 sequences were shown in Table 1. The 3' segment of hairpin H1 is labeled with 6-carbon amino group, and the 3' end of H2 is labeled with biotin.

[0037] Table 1

[0038] name Sequence (5'-3') H1 TCAACATCAGTCTGATAAGCTACCATGTGTAGATAGCTTTATCAGACT (6-carbon amino group labeled at the 3' end) H2 TAAGCTATCTACACATGGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of nucleic acid detection, in particular to a microRNA detection method based on non-enzymatic amplification and electrochemiluminescence principles. The detection method comprises the steps of: 1) designing DNA hairpin probes, i.e. designing the hairpin H1 and hairpin H2 sequences required by a non-enzymatic amplification system according to a non-enzymatic amplification principle and a detected microRNA sequence; 2) conducting electrochemiluminescence group marking; 3) performing hairpin probe pretreatment; 4) constructing a non-enzymatic amplification detection system; 5) carrying out product cleaning and separation; and 6) conducting signal detection. The method has the characteristics of high sensitivity, accuracy, fastness and simple operation, and the whole amplification process does not involve enzyme, so that the detection cost is greatly reduced.

Description

technical field [0001] The invention belongs to the technical field of nucleic acid detection, in particular to a method for detecting microRNA based on the principle of non-enzyme amplification combined with electrochemiluminescence. Background technique [0002] microRNA (miRNA) is a class of non-coding, endogenous RNA with a length of 19-25 nucleotides. It is widely distributed in eukaryotic cells. In recent years, researchers have discovered hundreds of microRNAs in animals and plants, and determined the main functions of microRNAs. This type of RNA mainly has a regulatory function, and its in vivo synthesis process mainly includes: first, transcribe a longer primary transcript from the non-coding sequence in the genome; then, the primary transcript is produced by cutting and processing different nucleases. This type of RNA can be assembled into the RNA-induced silencing complex, recognize the target mRNA through complementary base pairing, and guide the silencing comp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N21/76
Inventor 周小明邢达廖玉辉
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com