Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

MiRNA (micro ribose nucleic acid)-874 and application of miRNA-874antisense nucleotide

A technology of miRNA-874 and antisense nucleotides, which can be used in medical preparations containing active ingredients, gene therapy, cardiovascular system diseases, etc., and can solve the problem of unidentified key miRNAs

Active Publication Date: 2013-03-20
INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although more and more miRNAs have been discovered as biomarkers and therapeutic targets of human diseases, the key miRNAs in heart diseases of cardiac hypertrophy and myocardial fibrosis have not been identified, and their functions are of great concern to researchers in the field. challenge

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiRNA (micro ribose nucleic acid)-874 and application of miRNA-874antisense nucleotide
  • MiRNA (micro ribose nucleic acid)-874 and application of miRNA-874antisense nucleotide
  • MiRNA (micro ribose nucleic acid)-874 and application of miRNA-874antisense nucleotide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 The heart weight ratio and cardiac function of miRNA-874 transgenic mice are comparable to those of wild type no significant change than

[0041] Heart weight ratio analysis was performed on the hearts of miRNA-874 transgenic mice and wild-type mice, and the number of samples for each of the two groups of mice was 26. Experimental results such as figure 1 A shows that miRNA-874 transgenic mice have no significant increase in heart weight ratio compared with wild-type mice, indicating that miRNA-874 transgenic mice themselves have no obvious changes in hypertrophic phenotype.

[0042] The indicators of cardiac function detected at the same time include left ventricular posterior wall thickness (LVPWd) and fractional shortening (FS). Such as figure 1 As shown in B, the experimental results showed no significant difference in heart function between miRNA-874 transgenic mice and wild-type mice.

experiment example 2

[0043] Experimental Example 2 miRNA-874 transgenic mice were stimulated with PE (phenylephrine) and wild Heart weight ratio and heart function have been significantly changed compared with raw mice

[0044] The hearts of miRNA-874 transgenic mice and wild-type mice were injected with hypertrophy-stimulating factor PE. Among them, 6 miRNA-874 transgenic mice and 6 wild-type mice were used, and the dosage of PE was 75mg / kg / day. The control groups were miRNA-874 transgenic mice and wild-type mice treated with saline instead of PE. Heart-to-weight ratio analysis was performed after two weeks, see figure 2 A in Experimental results such as figure 2 As shown in A, the heart weight ratio of miRNA-874 transgenic mice after PE treatment was significantly increased compared with the control group, indicating that miRNA-874 transgenic mice after PE treatment had obvious hypertrophic phenotype changes .

[0045] The detection of cardiac function includes LVPWd (left ventricula...

experiment example 3

[0046] Experimental example 3 Changes in the expression level of miRNA-874 under the stimulation of PE and endothelin (ET-1) change

[0047] For the hypertrophy model of cardiomyocytes, adopt the method established in our laboratory to culture the primary cardiomyocytes of rat suckling rats, and treat the cardiomyocytes with PE and ET-1 (the dosage of PE is 50μM; the dosage of ET-1 is 100nM) , at different times in culture, extract the total RNA of the cells, and use real-time fluorescent quantitative PCR technology to detect (see the following literature: W.-Q.Tan, Kun Wang, et al., Foxo3a Inhibits Cardiomyocyte Hypertrophy through Transactivating Catalase.J Biol Chem.2008 October 31;283(44):29730-29739)

[0048] Specifically, the gene sequence of miRNA-874 was amplified by PCR

[0049] (TTAGCCCTGCGGCCCCACGCACCAGGGTAAGAGAGACTCGCTTCCTGCCCTGGCCCGAGG, SEQ ID NO: 3) and its upstream and downstream sequences of nearly 200 bp each, the amplified fragment is about 476bp, specif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a (micro ribose nucleic acid)-874 and an application of a miRNA-874 antisense nucleotide, and in particular relates to the application of the miRNA-874 antisense nucleotide in preparing pharmaceutical compositions for treating and preventing serious heart diseases (myocardial hypertrophy and myocardial fibrosis) and the application of the miRNA-874 antisense nucleotide in preparing the pharmaceutical compositions for diagnosing or prognosing the heart diseases. The miRNA-874 antisense nucleotide can control cardiac hypertrophy and cardiomyocyte hypertrophy and also has the functions of improving a cardiac function and inhibiting cardiac structure remodeling and cardiac fibering. The miRNA-874 antisense nucleotide can be used as a novel target of drug action, has a function of controlling the myocardial hypertrophy and has an important meaning for clinically preventing and treating heart diseases of cardiac fibering, coronary heat disease, heart failure and the like which are caused by cardiomyocyte hypertrophy.

Description

technical field [0001] The present invention relates to a new drug use of endogenous non-coding small RNAs, in particular to the use of miRNA-874 and its antisense nucleotides, especially to the preparation of miRNA-874 and its antisense nucleotides for diagnosis 1. Use in medicines for preventing and treating heart diseases, belonging to the field of diagnosis, prevention and treatment of heart diseases. Background technique [0002] Cardiovascular diseases mainly include hypertension, coronary heart disease, congestive heart failure, etc. At present, cardiovascular disease is still the number one killer of human health. Seventeen million people die from cardiovascular disease every year worldwide, and its mortality rate is close to the sum of all cancer mortality rates. In my country, with the improvement of people's living standards and the change of diet structure, the mortality rate of cardiovascular diseases is on the rise, surpassing cancer as the number one cause of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K31/7105A61P9/00A61P9/10
Inventor 李培峰王昆
Owner INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com