LAMP kit for rapid detection of Listeria monocytogenes
A technology of Listeria monocytogenes and a kit, applied in the field of LAMP kits, can solve the problems of time-consuming, labor-intensive, poor specificity, time-consuming and labor-intensive, etc., and achieve the effects of high repeatability, simple steps and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] 1. Composition and preparation of LAMP kit for rapid detection of Listeria monocytogenes
[0076] a) LAMP reaction mixture
[0077] The LAMP reaction mixture consists of 2.5 μl of LAMP 10×buffer, 2.0 μl of 10 μmol / L internal primers FIP and BIP, 1.0 μl of 10 μmol / L external primers F3 and B3, 3.0 μl of 10 mmol / L dNTPs, 50 mmol / LMgSO 4 3.0 μl, 5.0mol / L betaine, 4.5 μl, Bst DNA polymerase large fragment 1.0 μl, the total volume of the reaction solution is 20 μl.
[0078] Wherein the primer sequence is as follows:
[0079] Upstream outer primer F3: 5'-TGTTACTAAAGAGCAGTTGC-3';
[0080] Downstream outer primer B3: 5′-TTACGGCTTTGAAGGAAGA-3′;
[0081] Upstream internal primer FIP: 5′-TAAACTTGACGGCCATACGCCGCTTGGAGTGAATGCAGAA-3′;
[0082] Downstream inner primer BIP: 5′-
[0083] CTGCTTTTGATGCTGCCGTATATTTTGTTAGTTTCTACATCACCTGA-3′;
[0084] b) Standard positive template
[0085] The standard positive template pMD18-T-hlyA is a pMD18-T-hlyA vector composed of a 356-base-pa...
Embodiment 2
[0095]1. The composition and preparation of the new rapid visual detection LAMP kit for Listeria monocytogenes is different from the kit described in Example 1 in that the specific primer sequences are different. The primer sequences of this kit are as follows:
[0096] Upstream outer primer F3: 5'-GAACCTACAAAGACCTTCCA-3';
[0097] Downstream outer primer B3: 5'-AGATTTTCCGCTTACGGC-3';
[0098] Upstream internal primer FIP: 5′-GGATTTTCTGCATTCACTCCAAGCGATTTTTCGGCAAAGCTGT-3′;
[0099] Downstream inner primer BIP: 5′-
[0100] TCCTGCATATATCTCAAGTGTGGCGCTTTTACTTTAGTACTATGGGAAT-3′;
[0101] 2. The method for detecting Listeria monocytogenes using the PCR kit for rapidly detecting Listeria monocytogenes in industrial food based on the loop-mediated isothermal amplification technology is exactly the same as the method described in Example 1, and the test was repeated 3 times , the test results obtained are the same, the experimental group has precipitation, and the control group ha...
Embodiment 3
[0103] 1. The composition and preparation of the new rapid visual detection LAMP kit for Listeria monocytogenes is different from the kit described in Example 1 in that the specific primer sequences are different. The primer sequences of this kit are as follows:
[0104] Upstream outer primer F3: 5'-GAACCTACAAAGACCTTCCA-3';
[0105] Downstream outer primer B3: 5'-AGATTTTCCGCTTACGGC-3';
[0106] Upstream inner primer FIP: 5′-
[0107] GGATTTTCTGCATTCACTCCAAGCGATTTTTCGGCAAAGCTGTT-3';
[0108] Downstream inner primer BIP: 5′-
[0109] TCCTGCATATATCTCAAGTGTGGCGCTTTTACTTTAGTACTATGGGAAT-3′;
[0110] 2. The method for detecting Listeria monocytogenes using the PCR kit for rapidly detecting Listeria monocytogenes in industrial food based on the loop-mediated isothermal amplification technology is exactly the same as the method described in Example 1, and the test was repeated 3 times , the test results obtained are the same, the experimental group has precipitation, and the contro...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap